Efecto de factores ambientales sobre la regulación del desarrollo de ...

Universidad de Córdoba

Efecto de factores ambientales sobre la

regulación del desarrollo de la hoja

primaria de plantas de girasol

(Helianthus annuus L.)

Tesis doctoral

Lourdes de la Mata Sáez

2015

TÍTULO:Efecto de factores ambientales sobre la regulación del desarrollo de la hoja primaria de plantas de girasol (Helianthus annuus L.) AUTOR: Lourdes de la Mata Sáez

© Edita: Servicio de Publicaciones de la Universidad de Córdoba. 2016 Campus de RabanalesCtra. Nacional IV, Km. 396 A14071 Córdoba

www.uco.es/[email protected]

Título: Efecto de factores ambientales sobre la regulación del desarrollo de la hoja

primaria de plantas de girasol (Helianthus annuus L.)

Autora: Lourdes de la Mata Sáez

Departamento de Botánica, Ecología y Fisiología Vegetal

Universidad de Córdoba

Tesis Doctoral

Efecto de factores ambientales sobre la regulación del

desarrollo de la hoja primaria de plantas de girasol

(Helianthus annuus L.)

Autora:

Lourdes de la Mata Sáez

Directoras del trabajo:

Eloísa Agüera Buendía - Purificación de la Haba Hermida Córdoba, Diciembre de 2015

AGRADECIMIENTOS

Una tesis doctoral es siempre el resultado de años de dedicación, esfuerzo y

paciencia, pero nunca llegaría a término sin la ayuda en diferentes planos de algunas

personas. Por ello me gustaría dar las gracias a mis directoras, Eloísa Agüera y

Purificación de la Haba, por la confianza que depositaron en mí y por su tarea de

supervisión a lo largo de estos años. A Purificación Cabello, por su apoyo constante y su

asesoramiento. Muchas gracias por todo lo que he aprendido de vosotras y por haberme

introducido en mi carrera científica. Mi agradecimiento a Manuel Pineda por su respaldo a

este proyecto y a Josefa Alamillo, que me inició en el conocimiento de la Biología

Molecular con generosidad y paciencia. Muchas gracias también a Guadalupe Alcalá, que

desde la secretaría del departamento siempre estuvo cuando la necesitaba, con una

solución para cada problema. No olvido a mis compañeros de departamento, a Vanessa,

Manuel y Álvaro, gracias también a vosotros por compartir inolvidables momentos en la

Universidad y fuera de ella, en esta importante etapa de mi vida. Y por supuesto, todo mi

cariño a mi familia y a mis amigos, que con su apoyo incondicional me dieron fuerzas y

estuvieron siempre a mi lado.

ÍNDICE

Abreviaturas ................................................................................................. 1

1. RESUMEN .............................................................................................. 3

2. INTRODUCCIÓN .................................................................................. 7

2.1. Aspectos generales ............................................................................. 9

2.2. El CO2 y las plantas ......................................................................... 11

2.3. Importancia del nitrógeno en las plantas ......................................... 12

2.4. Efectos de la irradiancia en las plantas ............................................ 16

2.5. Efectos de la temperatura en las plantas ......................................... 18

2.6. El proceso de senescencia ................................................................. 20

3. OBJETIVOS ......................................................................................... 23

3.1. Capítulo I ......................................................................................... 25

3.2. Capítulo II ........................................................................................ 26

3.3. Capítulo III ...................................................................................... 26

3.4. Capítulo IV ...................................................................................... 27

4. CAPÍTULO I

Growth under elevated atmospheric CO2 concentration accelerates leaf

senescence in sunflower (Helianthus annuus L.) plants ......................... 29

5. CAPÍTULO II

Elevated CO2 concentrations alter nitrogen metabolism and accelerate

senescence in sunflower (Helianthus annuus L.) plants ......................... 41

6. CAPÍTULO III

Study of the senescence process in primary leaves of sunflower

(Helianthus annuus L.) plants under two different light intensities ........ 49

7. CAPÍTULO IV

High temperature promotes early senescence in primary leaves of

sunflower (Helianthus annuus L.) plants ............................................... 61

8. DISCUSIÓN .......................................................................................... 75

9. CONCLUSIONES ................................................................................ 87

9.1. Capítulo I ......................................................................................... 89

9.2. Capítulo II ........................................................................................ 89

9.3. Capítulo III ...................................................................................... 90

9.4. Capítulo IV ...................................................................................... 90

10. BIBLIOGRAFÍA ................................................................................. 91

Abreviaturas

1

− APX: Ascorbato peroxidasa − C/N: Razón carbono/nitrógeno − Citb557: Citocromo b557 − FAD: Flavín adenín dinucleótido − GDH: Glutamato deshidrogenasa − GOGAT: Glutamato sintasa − GS: Glutamina sintetasa − HI: Alta irradiancia − HO˙: Radical hidroxilo − IPCC: Panel Intergubernamental de Cambio Climático − LI: Baja irradiancia − MoCo: Cofactor de molibdeno − N2O: Oxido nitroso − NiR: Nitrito reductasa − NO: Oxido nítrico − NO2

-: Nitrito − NO3

-: Nitrato − NR: Nitrato reductasa − O2

-: Radical superóxido − PFD: Densidad de flujo fotónico − PSII: Fotosistema II − ROS: Especies reactivas de oxígeno − Rubisco: Ribulosa-1,5-bisfostato carboxilasa/oxigenasa − SLM: Masa foliar específica − SOD: Superóxido dismutasa − XET: Xiloglucano endotransglicosidasa

1. RESUMEN

Resumen

5

Resumen

Los procesos bioquímicos, biológicos y morfogenéticos de las plantas de girasol

(Helianthus annuus L.) y en general de todas las plantas, se ven afectados por el cambio

climático en curso, produciendo alteraciones en el desarrollo, crecimiento y productividad de

los cultivos. El cambio climático actual está produciendo modificaciones en los ecosistemas

siendo importante el estudio de plantas con mayor capacidad adaptativa a las modificaciones

medioambientales.

En el presente trabajo se han estudiado los cambios fisiológicos y metabólicos que

ocurren en las plantas de girasol durante su desarrollo, bajo diferentes factores ambientales:

elevada concentración de dióxido de carbono (CO2) atmosférico, elevada temperatura y

variaciones en la intensidad lumínica. Para ello hemos enfocado este estudio abordando, en

diferentes capítulos, estos tres factores ambientales: elevada concentración atmosférica de

CO2 (Capítulo I y II) modificación en la intensidad luminosa (Capítulo III), y elevada

temperatura (Capítulo IV). Se han determinado las variaciones en los parámetros de

crecimiento, así como los cambios en el contenido de pigmentos fotosintéticos, asimilación

fotosintética de CO2, contenido en carbohidratos, actividades y niveles de expresión de

enzimas del metabolismo del nitrógeno y el estado oxidativo del tejido vegetal. En general, se

ha observado que los diferentes factores ambientales provocan en las plantas de girasol

alteraciones que inducen la aceleración del proceso de senescencia en la hoja primaria, cuyo

principal fin es la movilización de nutrientes a los órganos en crecimiento para mantener su

funcionalidad. Estos resultados contribuyen al conocimiento de los efectos que el

calentamiento global va a tener sobre los diferentes cultivos ya que los factores ambientales

estudiados pueden verse afectados por él. Este estudio se ha realizado en plantas de girasol

debido a la gran importancia del cultivo, ya que su uso es fundamental en la alimentación

humana (semilla o aceite) y de animales (forraje), también es importante por su utilización en

procesos de biorremediación y en la producción de biodiesel así como por su valor

ornamental.

Resumen

6

Abstract

Climate change is affecting the biochemical, biological and morphogenetic processes

in sunflower plants (Helianthus annuus L.) and in all plants, producing alterations in growth,

development and productivity of the crops. The current climate change is causing changes in

the ecosystems; therefore, the study of plants with increased ability to adapt to these

environmental changes is important.

In this work, physiological and metabolic changes during the development of

sunflower plants under different atmospheric conditions have been studied. These plants were

subjected to high atmospheric CO2 concentration, high temperature and variations in light

intensity. The responses to the different conditions were addressed in different chapters of

this thesis: high atmospheric CO2 concentration (chapters I and II), changes in the light

intensity (chapter III) and high temperature (chapter IV). During this project, different growth

related parameters were measured such as the content of photosynthetic pigments, CO2

photosynthetic fixation, content of carbohydrates, activity and level of expression of enzymes

related to the nitrogen metabolism and the plant tissue oxidative state. In general, it was

observed that different environmental factors resulted in alterations in sunflower plants;

which induced the acceleration of the process of senescence in primary leaves. The main aim

of this process is to transport nutrients to the young tissues in order to maintain their

functionality. These results add insight into the knowledge of the effects of global warming

on sunflower crops since the studied atmospheric factors might be affected by it. This study

was conducted in sunflower plants because of their importance as a crop. The use of

sunflower is essential in the diet of humans (seeds and oil) and animals (fodder). Its use is

also important in bioremediation, biodiesel production and ornamental use.

2. INTRODUCCIÓN

Introducción

9

2.1. Aspectos generales

El girasol tiene su origen en el continente Americano, más concretamente en México

en el 2600 a.C., en el siglo XVI llegó a Europa y allí se extendió al resto del mundo donde se

cultiva de forma intensiva con fines alimenticios (Putt, 1997). El girasol es una planta anual

de la familia de las asteráceas, durante los estadíos más tempranos del crecimiento, la flor

gira orientándose hacia los rayos del sol, sin embargo, cuando la planta alcanza la madurez se

orienta hacia el este. El girasol es una de las cinco fuentes más importantes de aceite

comestible a nivel mundial, por lo tanto posee un gran valor tanto agronómico como

económico (Cantamutto y Poverene 2007). Esta planta también se usa en procesos de

fitorremediación, en la producción de biodiesel y con fines ornamentales (Mani et al. 2007;

Arzamendi et al. 2008).

Los procesos bioquímicos, biológicos y morfogenéticos de las plantas de girasol y en

general de todas las plantas, se ven afectados por el cambio climático, produciéndose

alteraciones en el desarrollo, en el crecimiento y en la productividad (Bazzaz y Fajer 1992).

El Convenio Marco sobre cambio climático de las Naciones Unidas (1992) define el cambio

climático como una modificación del clima atribuida directa o indirectamente a la actividad

humana que altera la composición de la atmósfera y que se suma a la variabilidad natural del

clima observada durante períodos de tiempo comparables.

Los gases atmosféricos más importantes que producen el efecto invernadero en la

atmósfera son: CO2, N2O, NO y CH4; éstos absorben la radiación infrarroja que emite la

tierra por refracción de la luz que recibe del sol, manteniendo así una temperatura apropiada

para la vida en la tierra. Por tanto, el CO2 es un componente natural y necesario en la

atmósfera terrestre, sin embargo, debido a la actividad humana y a la quema de combustibles

fósiles para la obtención de energía, los niveles de CO2 han aumentado hasta valores muy

elevados, como se puede observar en la curva Keeling (Keeling 1960) (Fig. 1).

Introducción

10

Figura 1. Variaciones de la concentración de CO2 a lo largo de los años. Última medida 9 de enero de 2015. (Scripps institution of oceanography, UC San Diego)

El Panel Intergubernamental de Cambio Climático (IPCC) ha predicho que los niveles

de CO2 entre 2060 y 2090 van a alcanzar unas concentraciones de 660-790 µL L-1 (IPCC

2007). Las emisiones continuadas de este gas es una de las causas del cambio climático, ya

que se produce un aumento de la temperatura debido a la capacidad del CO2 de absorber luz

infrarroja (Schneider 1989; Taylor y MacCracken 1990).

El uso intensivo de fertilizantes químicos altera el ciclo global del nitrógeno

aumentando los niveles de N2O y NO lo que favorece también el calentamiento global

(Templer et al. 2012) (Fig. 2).

Introducción

11

Figura 2. Gases y procesos involucrados en el efecto invernadero. (Tomado de Templer et al. 2012)

El cambio climático ya está produciendo alteraciones importantes en los ecosistemas,

dando lugar a fenómenos extremos relacionados con el clima así como sequías, inundaciones,

olas de calor, ciclones, etc. (IPCC 2014). Gruissem et al. (2012) indican que es importante el

estudio de plantas con mayor flexibilidad y capacidad adaptativa a las modificaciones que

produce el cambio climático, de aumento de CO2, temperatura y variaciones de la intensidad

lumínica.

2.2. El CO2 y las plantas

En general elevados niveles de CO2, tienden a aumentar el crecimiento de las plantas

y a producir grandes cantidades de biomasa especialmente en plantas C3. El tamaño de las

hojas viene determinado por la división y expansión celular, dichos procesos están

coordinados y controlados durante la organogénesis por una serie de factores que incluyen

hormonas vegetales, y que responden a señales ambientales (Nishimura et al. 2004; Tsukaya

2006; Riikonen et al. 2010). La elevada concentración de CO2 en la atmósfera puede influir

Introducción

12

positivamente tanto en la división como en la expansión celular (Kinsman et al. 1997). El

aumento de la expansión celular está asociado con el incremento de la extensibilidad de la

pared celular y de la actividad de enzimas que fluidifican la pared celular, tal es el caso de la

xiloglucano endotransglicosidasa (XET) (Ferris et al. 2001). Se ha descrito que en hojas de

soja y Betula papyrifera creciendo bajo una atmósfera enriquecida en CO2, determinados

genes que participan en el ciclo celular (codificando histonas) o que fluidifican la pared

celular (codificando expansinas y XET), incrementan su expresión (Gupta et al. 2005;

Ainsworth et al. 2006; Druart et al. 2006; Kontunen-Soppela et al. 2010).

La elevada concentración de CO2 incrementa la velocidad de fotosíntesis en plantas

C3 ya que la enzima ribulosa-1,5-bisfostato carboxilasa/oxigenasa (rubisco), involucrada en

los procesos fijación de CO2 y fotorrespiración, no se encuentra saturada a la concentración

de CO2 ambiental (Drake et al. 1997). Por tanto, un incremento en el CO2 atmosférico

aumentará el nivel de CO2 interno de la hoja, así como la razón CO2/O2 afectando a la rubisco

y favoreciendo así, la reacción de carboxilación frente a la de oxigenación. Las elevadas

concentraciones de CO2 pueden reducir el proceso de fotorrespiración en plantas C3 y por

tanto la producción de peróxido de hidrógeno (H2O2) celular derivada del metabolismo del

glicolato (Pritchard et al. 2000).

2.3. Importancia del nitrógeno en las plantas

En la mayoría de los suelos, el nitrógeno se encuentra fundamentalmente en forma de

nitrato, debido a que el amonio, incluso el añadido al suelo como fertilizante, es rápidamente

oxidado a nitrato por las bacterias nitrificantes. En la planta, para convertir el nitrógeno

nítrico en nitrógeno amónico, proceso conocido como reducción asimilatoria del nitrato, se

precisan dos reacciones consecutivas. En la primera de ellas, catalizada por la enzima

citosólica nitrato reductasa (NR), el nitrato es reducido a nitrito (NO2-) con el consumo de dos

electrones procedentes de una molécula de NADH, y en la segunda, catalizada por la enzima

nitrito reductasa (NiR), el nitrito es reducido a amonio en los cloroplastos en una reacción

que precisa de 6 electrones que son aportados por la ferredoxina reducida (Fedred).

Introducción

13

NR

NiR

NO3- + NAD(P)H + H+ NO2

- + NAD(P)+ + H2O

NO2- + 6 Fdred + 8 H+ NH4

+ + 6 Fdox + 2 H2O

La NR de eucariotas está constituida por dos subunidades idénticas, cada una de ellas

contiene una molécula de flavín adenín dinucleótido (FAD), citocromo b557 (Citb557) y un

átomo de molibdeno integrado en el denominado cofactor de molibdeno (MoCo), que se

considera el sitio activo de reducción de nitrato. Los tres cofactores participan en serie en la

transferencia de electrones desde el NAD(P)H al nitrato estando unidos entre sí por regiones

bisagra muy sensibles a las proteasas (Maldonado et al. 2000). El poder reductor requerido

para su asimilación procede de las reacciones lumínicas de la fotosíntesis en la hoja o de la

respiración en la raíz. La asimilación de nitrato está regulada por factores endógenos y/o

exógenos tales como el nitrato, compuestos carbonados y la luz. La NR está sujeta a un

mecanismo de regulación post-traduccional en respuesta a los cambios luz/oscuridad como

resultado de una fosforilación reversible de la proteína. En plantas de pepino (Cucumis

sativus L.) se ha visto que la NR puede encontrarse activa (desfosforilada) en la luz o inactiva

(fosforilada) en oscuridad (De la Haba et al. 2001). El amonio procedente de la reducción

asimilatoria del nitrato, junto al generado en otras reacciones metabólicas, es sustrato de

enzimas tales como la glutamina sintetasa (GS) y glutamato deshidrogenasa (GDH).

Actualmente se considera que el par enzimático formado por la GS y la glutamato sintasa

(GOGAT) constituye la principal vía para la asimilación de amonio (Bernard y Habash

2009). El amonio puede proceder no sólo de la reducción del nitrato, sino también de la

fotorrespiración y del catabolismo de proteínas de reserva (Wallsgrove et al. 1987). A través

de la vía GS/GOGAT, el amonio se incorpora inicialmente a una molécula de glutamato

generándose glutamina. En esta reacción catalizada por la GS se requiere ATP y la presencia

de cationes divalentes. A continuación, la GOGAT cataliza la transferencia reductiva del

grupo amido de la glutamina al 2-oxoglutarato, formándose dos moléculas de glutamato. El

donador de electrones en tejidos fotosintéticos es normalmente la ferredoxina reducida (Forde

y Lea 2007) (Fig. 3).

Introducción

14

Figura 3. Asimilación de amonio en el ciclo GS/GOGAT. (Tomado de Taiz y Zeiger 2010)

Una de las dos moléculas de glutamato producidas en la reacción de la GOGAT se

recicla actuando de nuevo como aceptora de amonio, mientras que la otra, en reacciones

catalizadas por aminotransferasas, transfiere su grupo amino a diversos oxoácidos para la

formación de los respectivos aminoácidos (Lea y Miflin 2003).

La enzima GS es una proteína octamérica con una masa molecular de 320-360 kDa y

con una alta afinidad por el amonio, evitando así su toxicidad. En las hojas existen dos

isoenzimas, GS1 y GS2, con distinta composición de subunidades y diferente localización

celular: la GS1 está localizada en el citosol y la GS2 en el cloroplasto (Maldonado et al.

2000). A lo largo del desarrollo de la hoja de girasol se ha comprobado que la actividad de la

isoforma GS2 disminuye mientras que la actividad de la isorforma GS1 aumenta (Cabello et

al. 2006). Estas dos isoenzimas se regulan de forma diferente en distintos tipos celulares y

organismos y en respuesta a diferentes señales del desarrollo, metabólicas y

medioambientales (Zozaya-Hinchliffe et al. 2005). Diferentes estudios mostraron que tanto

las isoforma cloroplástica como la isoforma citosólica de la GS se afectan por estrés abiótico

(Brugière et al. 1999; Martinelli et al. 2007; Bernard y Habash, 2009).

La GDH cataliza el proceso reversible de aminación/desaminación entre el 2-

oxoglutarato y el glutamato (Fig. 4). La GDH aminante cataliza la incorporación de un grupo

amino al 2-oxoglutarato para formar glutamato. La reacción tiene lugar en la mitochondria y

como resultado de este proceso se producen aminoácidos con el fin de suministrar nitrógeno

orgánico a los órganos en crecimiento (Lehmann y Ratajczak 2008).

Introducción

15

Figura 4. Reacción de aminación y desaminación de la GDH. (Tomado de Taiz y Zeiger 2010)

La GDH desempeña un papel importante en la asimilación de amonio especialmente cuando éste

se encuentra a concentraciones elevadas y en condiciones de estrés (Purnell y Botella 2007).

Numerosos estudios indican un papel predominante de la GDH desaminante en procesos

catabólicos, entre ellos destacan el proceso de senescencia, la germinación de las semillas, en

situaciones limitantes de carbono y durante el periodo de oscuridad (Miflin y Habash 2002).

Se han realizado estudios acerca de la regulación de esta enzima y se ha observado que hay

muchas especies en las que los carbohidratos son reguladores negativos de la expresión y la

actividad de la GDH (Melo-Oliveira et al. 1996). Sin embargo, el amonio y la edad de la hoja

la regulan positivamente, de forma que en plantas de tabaco durante la senescencia,

incrementan los niveles de transcritos de la GDH en hojas fuentes así como los niveles de

amonio (Laurière y Daussant 1983; Masclaux et al. 2000; Masclaux-Dubresse et al. 2005;

Purnell y Botella 2007). La enzima GDH junto con la isoforma GS1 pueden ser considerados

marcadores metabólicos en plantas, los cuales incrementan durante la senescencia de la hoja,

y están implicados en la movilización de nitrógeno (Pageau et al. 2006).

Introducción

16

2.4. Efectos de la irradiancia en las plantas

Otro factor que afecta al crecimiento y desarrollo de la planta es la irradiancia junto

con el tiempo de exposición a la misma. Elevada intensidad lumínica durante largos periodos

de tiempo provoca una disminución del contenido en clorofila y un daño irreversible en el

fotosistema II (PSII), inhibiendo la fotosíntesis, disminuyendo el crecimiento, provocando

peroxidación de lípidos de membrana y acelerando el proceso de senescencia en las plantas

(Prášil et al. 1992; Mishra y Shingal 1992; Melis 1999; Schansker y van Rensen 1999;

Astolfi et al. 2001). Xue et al. (2012), estudiaron el efecto de la elevada irradiancia sobre la

senescencia en Alhagi sparsifolia, llegando a la conclusión de que la disminución de

actividad del PSII se debe tanto a un descenso de actividad en el centro de reacción del PSII,

como a una disminución de la transferencia de electrones entre la plastoquinona y el

citocromo b6/f. Las membranas fotosintéticas pueden ser fácilmente dañadas por la elevada

cantidad de energía absorbida por los pigmentos de forma que, si esta energía no puede ser

almacenada, es requerido un mecanismo de protección. Para evitar el daño fotooxidativo, las

plantas tienen sistemas fotoprotectores de alta eficiencia que operan mediante dos

mecanismos. El primero implica la disipación del exceso de energía de excitación en forma

de calor en los pigmentos antena del PSII, proceso que está relacionado con el ciclo de las

xantofilas. El proceso fotoquímico conlleva el bombeo de protones desde el estroma

cloroplástico al lumen tilacoidal produciendo una bajada de pH en el interior del lumen e

induciendo la activación de la enzima violaxantina de-epoxidasa, localizada en la cara interna

de los sacos tilacoidales. Esta enzima es la encargada de transformar la violaxantina en

zeaxantina a través del intermediario, anterazantina, en cada paso la violaxantina pierde uno

de los dos grupos epoxi que posee en cada uno de sus anillos. La zeaxantina es capaz de

recibir la energía directamente de la clorofila excitada disipándola en forma de calor, sin

emisión de radiación. El proceso se invierte cuando la luz desaparece o se va haciendo

progresivamente menor (Fig. 5).

Introducción

17

Figura 5. Efecto de la intensidad lumínica sobre el ciclo de las xantofilas. (Tomado de Taiz y Zeiger 2010)

En el segundo mecanismo fotoprotector están involucradas enzimas antioxidantes

como la superóxido dismutasa (SOD), la cual convierte aniones superóxido en H2O2, la

catalasa y la ascorbato peroxidasa (APX), las cuales detoxifican el H2O2 (Asada 1999; Logan

et al. 2006). Una alta densidad de flujo fotónico (PFD) es una de las causas del estrés

oxidativo en plantas (Dat et al. 2000). Se han descrito cambios en la actividad y expresión de

enzimas antioxidantes en respuesta a estrés causado por alta intensidad luminosa, aunque en

diferente grado, dependiendo de la planta y de las condiciones del tratamiento (Hernández et

al. 2006; Ariz et al. 2010).

A los sistemas de fotoprotección se añaden los sistemas de reparación, de forma que

la acumulación de energía de excitación provoca la destrucción de una de las subunidades

proteicas de PSII, la denominada proteína D1. Esta proteína D1 es rápidamente sintetizada de

novo y reemplazada en el PSII, sin embargo, cuando la tasa de destrucción de la proteína D1

supera a la de síntesis y reparación, se incrementa la carga energética del sistema la cual no

puede ser transferida y los diferentes componentes moleculares pueden resultar

irreversiblemente dañados. Este proceso se conoce como fotoinhibición (Fig. 6).

Introducción

18

Figura 6. Protección y reparación del daño oxidativo. (Tomado de Taiz y Zeiger 2010)

2.5. Efectos de la temperatura en las plantas

El estudio del efecto de elevadas temperaturas sobre el crecimiento y el metabolismo

de plantas de girasol es de gran importancia, ya que el cambio climático va a determinar que

las temperaturas se eleven entre 2,5 y 6,5 °C durante este siglo (Christensen y Christensen

2007). La elevada temperatura afecta al crecimiento, desarrollo y distribución de las plantas

limitando la productividad de los cultivos al influir en todos los procesos fisiológicos de las

plantas. Estos hechos se deben a que la elevada temperatura condiciona la velocidad de las

reacciones enzimáticas, y modifica la estructura y actividad de macromoléculas. Igualmente

se conoce que la elevada temperatura modifica la composición y estructura de las membranas

celulares incrementando la fluidez de los lípidos de membrana y disminuyendo las

interacciones electrostáticas entre los grupos polares de las proteínas dentro de la fase acuosa

de la membrana y produciendo pérdida de iones (Li et al. 2015). Por ello, la fotosíntesis a

Introducción

19

elevada temperatura se ve alterada ya que se afectan las membranas tilacoidales además de la

forma y disposición tilacoidal (Semenova 2004). Por otro lado, la elevada temperatura

también produce fotoinhibición del PSII a través de su efecto sobre el complejo productor de

oxígeno, el cual se destruye por calor (Aro et al. 1993; Murata et al. 2007; Takahashi y

Murata 2008). La disminución de la tasa fotosintética puede ser también debida a que la

elevada temperatura provoca cierre estomático con el fin de evitar la pérdida de agua, lo que

desencadena un descenso en el intercambio de gases entre la hoja y la atmósfera (Greer y

Weedon 2012). También la tasa fotosintética está determinada por la capacidad de

carboxilación de la rubisco la cual es muy dependiente de la temperatura. A elevada

temperatura disminuye el estado de activación de la rubisco por inactivación de la enzima

rubisco activasa afectando así al proceso de carbamilación de la rubisco (Feller et al. 1998;

Jiang et al. 1999; Salvucci y Crafts-Brandner 2004; Demirevska-Kepova et al. 2005) (Fig. 7).

Figura 7. Activación de la rubisco a través del proceso de carbamilación. (Tomado de Buchanan et al. 2000)

También se ha observado que la elevada temperatura disminuye los niveles de

actividad de enzimas antioxidantes (Zhang et al. 2012) e induce en las plantas estrés

oxidativo (Foyer et al. 1994) ya que se producen especies reactivas de oxígeno (ROS) tales

como radical superóxido (O2-), H2O2 y radical hidroxilo (HO˙) (Dat et al. 1998). La

acumulación de ROS no sólo tiene consecuencias negativas en las células, sino que también

interviene en las vías de señalización del estrés, activando la síntesis de factores de

transcripción de proteínas de choque térmico (Xu et al. 2006).

Introducción

20

2.6. El proceso de senescencia

El proceso de senescencia se tiende a identificar con el estado final del ciclo de vida

de las plantas. Sin embargo, no es el resultado de un proceso de degeneración, sino un

proceso de desarrollo encaminado a conseguir el desmantelamiento y reciclaje ordenado de

una parte de las estructuras y moléculas que, en un determinado momento, ya no resultan

útiles para la planta (Lim et al. 2007). Es un proceso programado genéticamente y que puede

activarse prematuramente debido a los efectos de la exposición a estrés medioambiental o a la

falta de nutrientes (Quirino et al. 2000; Lim et al. 2003, 2007; Wingler et al. 2009). La acción

combinada de señales externas e internas puede estar involucrada en la inducción del proceso

de senescencia de la hoja a través de una serie de factores entre los que podemos destacar la

acumulación de azúcares en las hojas (Agüera et al. 2010).

La ontogenia de la hoja se puede dividir en tres fases: una primera fase de incremento

de la tasa fotosintética cuando la hoja se está expandiendo activamente, una fase de máxima

velocidad fotosintética de las hojas y finalmente una fase de senescencia prolongada que

comienza con la disminución de la velocidad de fotosíntesis (Gepstein 1988), por tanto la

senescencia es el último estadio en el desarrollo ontogénico de la hoja, después de un periodo

fotosintéticamente productivo. En el proceso de senescencia foliar se produce la

redistribución de nutrientes que determina el transporte de nitrógeno y otros nutrientes a

órganos en crecimiento y muerte celular una vez que la redistribución de nutrientes se ha

completado (Wiedemuth et al. 2005). El proceso de senescencia está asociado a procesos

tales como el descenso de la velocidad de fotosíntesis, la degradación de estructuras celulares

y a la disminución de pigmentos fotosintéticos y proteínas (Ougham et al. 2008), así como a

un incremento de peroxidación lipídica en las membranas celulares (Srivalli y Khanna-

Chopra 2004; Agüera et al. 2010). Durante la senescencia, las células de las hojas sufren

cambios drásticos en el metabolismo celular y una degeneración secuencial de estructuras

celulares (Nam 1997) que ocurren de forma ordenada y comienzan por la degradación del

cloroplasto, permaneciendo la integridad de las membranas, la compartimentación celular, las

mitocondrias y el núcleo intactos hasta la etapa final (Noodén et al. 1997; Gan y Amasino,

1997; Lee y Chen 2002).

El estado redox de las células foliares es también un marcador importante del proceso

de senescencia, el cual puede cambiar al incrementar los niveles de ROS. Las ROS son

moléculas químicamente reactivas que se forman continuamente como subproductos de

diferentes rutas metabólicas en diferentes compartimentos celulares (Foyer y Harbinson

Introducción

21

1994; Apel y Hirt 2004). Hay diferentes fuentes de ROS, por ejemplo el H2O2 y el O2-, que se

producen por la actividad metabólica del cloroplasto y/o peroxisoma en las células

senescentes. Los niveles de ROS se elevan cuando las plantas superiores son sometidas a

distintos tipos de estrés (Zulfugarov et al. 2011). Los componentes de defensa oxidativa se

encargan de eliminar estas ROS cuando las condiciones fisiológicas son estables (Alscher et

al. 1997), sin embargo, el equilibrio entre la presencia de ROS y su eliminación puede ser

alterado por factores medioambientales adversos (Polle 2001; Vanacker et al. 2006). Las

ROS en plantas son eliminadas mediante mecanismos enzimáticos y no enzimáticos, la SOD,

la catalasa, la APX y la glutatión reductasa son las enzimas responsables de los mecanismos

enzimáticos (Mittler 2002). Estas enzimas tienen un papel muy importante en el control de

los niveles de radicales libres (Irigoyen et al. 1992) así como en diferentes procesos

relacionados con la senescencia de la hoja (Procházková y Wilhelmová 2007). Cuando los

metabolitos de defensa y las enzimas responsables fallan en detoxificar las ROS, los procesos

biológicos y estructuras celulares se ven afectados (Asada 1999; Johnson et al. 2003).

La caracterización del proceso de senescencia foliar es importante desde el punto de

vista económico pues la aceleración de este proceso acorta la vida de la planta provocando un

menor rendimiento de las cosechas (Brutnell y Langdale, 1998).

3. OBJETIVOS

Objetivos

25

El objetivo principal de esta tesis doctoral ha sido estudiar el efecto de distintas

condiciones ambientales sobre el proceso de desarrollo de hojas de plantas de girasol

(Helianthus annuus L.) con objeto de determinar la implicación que el cambio climático en

curso va a tener sobre este cultivo. Para ello, hemos enfocado este estudio abordando, en

diferentes capítulos, tres de los factores ambientales más importantes que afectan al

desarrollo de las plantas: elevada concentración atmosférica del CO2 (Capítulo I y II),

variaciones en la intensidad luminosa (Capítulo III), y elevada temperatura (Capítulo IV).

Cada uno de estos factores ha sido estudiado en profundidad, planteándose objetivos más

específicos que se detallan a continuación:

3.1. Capítulo I

Growth under elevated atmospheric CO2 concentration accelerates leaf senescence in

sunflower (Helianthus annuus L.) plants

1. Determinar el posible efecto de la elevada concentración de CO2 atmosférico (800 µL

L−1) sobre el desarrollo de hojas primarias de girasol (16, 22, 32 y 42 días) y su

influencia sobre la inducción del proceso de senescencia. Para ello, se analizaron los

siguientes parámetros:

1.1.-Parámetros de crecimiento: peso seco, superficie foliar, masa foliar

específica (SLM) y proteína soluble.

1.2.-Contenido en pigmentos fotosintéticos: clorofila a, clorofila b, clorofila

total y carotenoides.

1.3.-Velocidad de fijación fotosintética de CO2, velocidad de transpiración y

conductancia estomática.

1.4.-Contenido en azúcares solubles (glucosa, fructosa, sacarosa) y almidón.

1.5.-Contenido de carbono, nitrógeno y razón carbono/nitrógeno (C/N).

1.6.-Estado oxidativo de la hoja: contenido en H2O2 y actividad de enzimas

antioxidantes (catalasa y APX).

Objetivos

26

3.2. Capítulo II

Elevated CO2 concentrations alter nitrogen metabolism and accelerate senescence in


2. Determinar los posibles cambios que una elevada concentración de CO2 atmosférica (800

µL L−1) produce en el metabolismo del nitrógeno durante el desarrollo de hojas primarias de

girasol (16, 22, 32 y 42 días) y su efecto sobre la inducción del proceso de senescencia. Para

ello se realizó:

2.1.-Diseño de cebadores moleculares para la amplificación de los genes

glutamina sintetasa: GS1 y GS2, estudio de la especificidad de los cebadores y

optimización.

2.2.-Análisis de expresión de los transcritos de las isoformas GS1 y GS2.

2.3.-Determinación de la actividad de las enzimas del metabolismo del

nitrógeno: NR, GS y GDH.

3.3. Capítulo III

Study of the senescence process in primary leaves of sunflower (Helianthus annuus L.) plants

under two different light intensities

3. Estudiar el efecto de dos intensidades lumínicas (350 y 125 µmoles de fotones m–2 s–1)

durante el desarrollo de hojas primarias de girasol (16, 22, 32, 42 y 50 días) y su efecto sobre

la inducción del proceso de senescencia. Para ello, se analizaron los siguientes parámetros:

3.1.-Parámetros de crecimiento: peso seco, superficie foliar, SLM y proteína

soluble.

3.2.-Contenido en pigmentos fotosintéticos: clorofila a, clorofila b y

carotenoides.




3.5.-Actividad de las enzimas de la asimilación del nitrógeno: NR, GS y GDH.



Objetivos

27

3.4. Capítulo IV

High temperature promotes an early senescence in primary leaves of sunflower (Helianthus

annuus L.) plants.

4. Estudiar el efecto del incremento de temperatura (régimen día/noche de 23/19 ºC a 33/29

ºC), durante el desarrollo de hojas primarias de girasol (16, 22, 28, 32 y 42 días) y determinar

su implicación sobre el proceso de senescencia. Par ello se analizaron:

4.1.- Parámetros de crecimiento: peso seco, superficie foliar, SLM y proteína

soluble.

4.2-Contenido en pigmentos fotosintéticos: clorofila a, clorofila b, razón clorofila

a/b y carotenoides.




4.6.-Actividad de las enzimas de la asimilación del nitrógeno: NR, GS y GDH.



4. CAPÍTULO I

Growth under elevated atmospheric CO2 concentration accelerates

leaf senescence in sunflower (Helianthus annuus L.) plants

Capítulo I

31

Journal of Plant Physiology 169 (2012) 1392– 1400

Contents lists available at SciVerse ScienceDirect

Journal of Plant Physiology

j ourna l ho mepage: www.elsev ier .de / jp lph

Growth under elevated atmospheric CO2 concentration accelerates leafsenescence in sunflower (Helianthus annuus L.) plants

Lourdes de la Mata, Purificación Cabello, Purificación de la Haba, Eloísa Agüera ∗

Departamento de Botánica, Ecología y Fisiología Vegetal, Área de Fisiología Vegetal, Facultad de Ciencias, Universidad de Córdoba, Campus de Rabanales, Edificio Celestino Mutis(C4), 3a planta, E-14071 Córdoba, Spain

a r t i c l e i n f o

Article history:Received 5 February 2012Received in revised form 24 April 2012Accepted 21 May 2012

Keywords:Elevated CO2

HexosesOxidative statusPhotosynthetic pigmentsSenescenceSunflower

a b s t r a c t

Some morphogenetic and metabolic processes were sensitive to a high atmospheric CO2 concentrationduring sunflower primary leaf ontogeny. Young leaves of sunflower plants growing under elevated CO2

concentration exhibited increased growth, as reflected by the high specific leaf mass referred to as dryweight in young leaves (16 days). The content of photosynthetic pigments decreased with leaf develop-ment, especially in plants grown under elevated CO2 concentrations, suggesting that high CO2 accelerateschlorophyll degradation, and also possibly leaf senescence. Elevated CO2 concentration increased theoxidative stress in sunflower plants by increasing H2O2 levels and decreasing activity of antioxidantenzymes such as catalase and ascorbate peroxidase. The loss of plant defenses probably increases theconcentration of reactive oxygen species in the chloroplast, decreasing the photosynthetic pigment con-tent as a result. Elevated CO2 concentration was found to boost photosynthetic CO2 fixation, especially inyoung leaves. High CO2 also increased the starch and soluble sugar contents (glucose and fructose) andthe C/N ratio during sunflower primary leaf development. At the beginning of senescence, we observeda strong increase in the hexoses to sucrose ratio that was especially marked at high CO2 concentration.These results indicate that elevated CO2 concentration could promote leaf senescence in sunflower plantsby affecting the soluble sugar levels, the C/N ratio and the oxidative status during leaf ontogeny. It is likelythat systemic signals produced in plants grown with elevated CO2, lead to early senescence and a higheroxidation state of the cells of these plant leaves.

© 2012 Elsevier GmbH. All rights reserved.

Introduction

Continuous emissions of CO2 from the burning of fossil fuels areexpected to raise global atmospheric CO2 concentrations. Humanactivities not only affect CO2 concentrations, but also alter theglobal nitrogen cycle by increasing the inputs of fixed forms ofnitrogen, mainly through extensive use of chemical fertilizers. TheIntergovernmental Panel on Climate Change (IPCC) has predictedthat the CO2 concentration may increase by 660–790 !L L−1 from2060 to 2090 (IPCC, 2007). This is expected to raise global temper-atures due to the CO2 capacity to absorb infrared light (Schneider,1989; Taylor and MacCracken, 1990). Therefore, continuous emis-sions of this gas at high levels are believed to cause climate change.One of the most obvious effects of climate change is its effect

Abbreviations: APX, ascorbate peroxidase; DW, dry weight; ROS, reactive oxygenspecies; RuBP, ribulose-1,5-bisphosphate; rubisco, ribulose-1,5-bisphophate car-boxylase/oxygenase; SLM, specific leaf mass; XET, xyloglucan endotransglycosidase.

∗ Corresponding author. Tel.: +34 957218367; fax: +34 957211069.E-mail addresses: [email protected] (L. de la Mata), [email protected] (P. Cabello),

[email protected] (P. de la Haba), [email protected] (E. Agüera).

on living beings, especially on plants, which have been found toexhibit alterations potentially affecting some steps of their growthcycle. Studies on various plant species have suggested that climatechanges will affect the development, growth and productivity ofplants through alterations in their biochemical, physiological andmorphogenetic processes (Bazzaz and Fajer, 1992).

Senescence is a stage of the plant growth cycle that involvesstrong metabolic and structural changes. Markers associated withleaf senescence in sunflower plants have shown that senescenceinitiates and progresses in primary leaves aged between 28 and42 days (Cabello et al., 2006). Senescence typically involves ces-sation of photosynthesis and degeneration of cellular structures,with strong losses of chlorophyll (Ougham et al., 2008), carotenoidsand proteins and a great increase of lipid peroxidation (Srivalliand Khanna-Chopra, 2004; Agüera et al., 2010). Senescence is notonly a degenerative process, but also a recycling process by whichnutrients are translocated from senescing cells to young leaves,developing seeds or storage tissues (Gan and Amasino, 1997).Leaf senescence is therefore an active, highly regulated and pro-grammed degeneration process, required for plant survival andcontrolled by multiple developmental and environmental signals(Lim et al., 2003). Senescence induction and development are both

0176-1617/$ – see front matter © 2012 Elsevier GmbH. All rights reserved.http://dx.doi.org/10.1016/j.jplph.2012.05.024

Capítulo I

32

L. de la Mata et al. / Journal of Plant Physiology 169 (2012) 1392– 1400 1393

seemingly governed by intrinsic and extrinsic factors that act byaccelerating or delaying the process. Some studies have shown thatleaf senescence is regulated not only by changes in hormone levels,photosynthetic performance, carbohydrate contents and specificsignals, but also by reactive oxygen species (ROS) (Hensel et al.,1993; Quirino et al., 2000; Orendi et al., 2001; Buchanan-Wollastonet al., 2003a).

Senescence can start prematurely by the effects of exposure toenvironmental stress or nutrient deprivation (Quirino et al., 2000;Lim et al., 2003, 2007; Wingler et al., 2009; Agüera et al., 2010).Leaf senescence in sunflower plants is accelerated by nitrogen defi-ciency (Agüera et al., 2010) and also by increased light exposureduring growth (De la Mata et al., 2012). Nitrogen deficiency andgrowth at high irradiance can result in sugar accumulation, whichmay induce leaf senescence through hexose-dependent signaling(Agüera et al., 2010; De la Mata et al., 2012). The combined effectof sugar accumulation and certain environmental conditions mayincrease the sugar sensitivity of plants. However, senescence mayalso be regulated by pathways that are independent of sugar sig-naling (Wingler et al., 2006; Van Doorn, 2008).

Elevated CO2 concentrations may enhance potential netphotosynthesis of C3 plants because ribulose-1,5-bisphophate car-boxylase/oxygenase (rubisco), an enzyme involved in both CO2fixation and photorespiration, is not CO2 saturated at the currentconcentration (Drake et al., 1997). Thus, an increase in ambientCO2 raises the leaf internal CO2 concentration and the CO2/O2ratio at the rubisco site, favoring carboxylation over oxygenationin ribulose-1,5-bisphosphate (RuBP). Therefore, elevated CO2 con-centrations can reduce photorespiration and thus cellular H2O2production associated with glycolate metabolism (Pritchard et al.,2000).

The impact of elevated CO2 concentrations on the oxidativestatus of leaves has been examined in various plant species(Cheeseman, 2006; Qiu et al., 2008), in which it seems to cause adecrease in the activity of some antioxidant enzymes and also in theconcentration of some antioxidants (Wustman et al., 2001), lead-ing to an increase of ROS levels in most plants (Erice et al., 2007).ROS are continuously formed as by-products of various metabolicpathways in different cellular compartments (Foyer and Harbinson,1994; Apel and Hirt, 2004). Under physiological steady-state con-ditions, these molecules are scavenged by different antioxidantdefense components (Alscher et al., 1997). However, the balancebetween ROS production and scavenging may be perturbed byadverse environmental factors that increase the intracellular lev-els of ROS (Polle, 2001; Vanacker et al., 2006). In plants, ROSare detoxified via enzymatic and non-enzymatic mechanisms; theenzymatic mechanisms involve superoxide dismutase, catalase,ascorbate peroxidase (APX) and other antioxidant enzymes suchas glutathione reductase (Mittler, 2002). These enzymes play a keyrole in controlling the level of oxygen free radicals (Irigoyen et al.,1992) and also in the regulation of various processes including leafsenescence (Procházková and Wilhelmová, 2007). The failure ofdefense metabolites and enzymes to detoxify ROS affects biolog-ical structures and processes, including DNA nicking, amino acidand protein oxidation, and lipid peroxidation (Asada, 1999; Johnsonet al., 2003), with the consequent generation of breakdown prod-ucts such as malondialdehyde (Esterbauer, 1982).

The effects of elevated CO2 concentrations on plant productivityhave been extensively studied. Overall, plants tend to increasegrowth and to produce greater amounts of biomass in the pres-ence of elevated CO2 concentrations. Also, the C3 photosyntheticpathway exhibits a greater relative increase than does the C4pathway under these conditions. Comparatively less researchhas been conducted on the effects of CO2 on plant development,with occasionally dissimilar results (Bazzaz, 1990; Pattersonand Flint, 1990). Elevated CO2 concentrations were found to

boost the expression of storage proteins, but also to upregulateendo-xyloglucan transferase and xyloglucan endotransglycosidase(XET) (Cosgrove, 1997), both of which are involved in the incor-poration of newly secreted xyloglucans into cell walls (Nishitaniand Tominaga, 1992; Fry et al., 1992; Wu and Cosgrove, 2000).This expression is correlated with the upregulation of genescoding for various elements of the cytoskeleton associated withgrowth, such as the alpha and beta subunits of tubulin, and variousactin-depolymerizing factors. Many physiological studies indicatethat expression of these genes may contribute to increased leafsize at elevated CO2 concentrations (Ferris et al., 2001).

The aim of this work was to examine the possible role of anelevated atmospheric CO2 concentration on the induction of sun-flower primary leaf senescence and the effects on biochemical andphysiological processes during leaf ontogeny.

Materials and methods

Plant material and growth

Seeds of sunflower (Helianthus annuus L.) from the isogeniccultivar HA-89 (Semillas Cargill SA, Seville, Spain) were surface-sterilized in 1% (v/v) hypochlorite solution for 15 min. After rinsingin distilled water, the seeds were imbibed for 3 h and then sownin plastic trays containing a 1:1 (v/v) mixture of perlite and ver-miculite. Seeds were germinated and plants grown in a growthchamber with a 16 h photoperiod (400 !mol m−2 s−1 of photo-synthetically active radiation supplied by “cool white” fluorescentlamps supplemented by incandescent bulbs) and a day/nightregime of 25/19 ◦C and 70/80% relative humidity. Plants wereirrigated daily with a nutrient solution containing 10 mM KNO3(Hewitt, 1966).

Plants were grown under these conditions for 8 days and thentransferred to different controlled-environment cabinets (SanyoGallenkam Fitotron, Leicester, UK) fitted with an ADC 2000 CO2gas monitor. The plants were kept under ambient CO2 levels(400 !L L−1) or elevated CO2 concentration (800 !L L−1) under con-stant conditions of photonic flux (400 !mol m−2 s−1), temperature(25/19 ◦C) and relative humidity (70/80%) for another 34 days.High-purity CO2 was supplied from a compressed gas cylinder (AirLiquid, Seville, Spain). Samples of primary leaves aged 16, 22, 32 or42 days were collected 2 h after the start of the photoperiod. Wholeleaves were excised and pooled in two groups: one was used tomeasure leaf area and specific leaf mass (SLM)–dry weight (DW),and the other was immediately frozen in liquid nitrogen and storedat −80 ◦C. The frozen plant material was ground in a mortar pre-cooled with liquid N2 and the resulting powder distributed intosmall vials that were stored at −80 ◦C until enzyme activity andmetabolite determinations.

The net CO2 fixation rate, transpiration rate and stomatal con-ductance were measured on attached leaves, using a CRS068portable infrared gas analyzer (IRGA) with the software CIRAS-2.Measurements were made on primary leaf samples from differentplants in each treatment.

Protein, pigment and H2O2 determinations

Frozen material was homogenized with cold extraction medium(4 mL g−1) consisting of 50 mM Hepes-KOH (pH 7), 5 mM MgCl2 and1 mM EDTA, and analyzed with the Bio-Rad protein assay accord-ing to Bradford (1976). Pigments were determined in plant extractsaccording to Cabello et al. (1998). For H2O2 determination, 1 gleaf material was ground with 10 mL cool acetone in a cold roomand passed through Whatman filter paper. Hydrogen peroxide was

Capítulo I

33

1394 L. de la Mata et al. / Journal of Plant Physiology 169 (2012) 1392– 1400

Fig. 1. Changes in specific leaf mass (SLM) referred to dry weight (DW), leaf area and soluble protein during sunflower primary leaf development. Plants were grown underdifferent atmospheric CO2 concentrations: 400 !L L−1 (closed circles) and 800 !L L−1 (open circles). Data are means ± SD of duplicate determinations from three separateexperiments. Asterisks indicate statistically significant differences among the CO2 treatments at the indicated times according to Student’s t-test (P < 0.05).

Capítulo I

34


0

2

4

6

8

10

12

14

16 22 32 42

(mgg

1 )

Days

Chlo

roph

yll a

A

0

1

2

3

4

5

16 22 32 42

(mgg

1 )

Days

Chlo

roph

yll b

B

0

5

10

15

20

16 22 32 42

(mgg

1 )

Days

Tota

l chl

orop

hyll

C

1

2

3

4

5

16 22 32 42

(mgg

1 )

Days

Caro

teno

ids

D

*

*

*

*

**

*

*

**

*

*

* **

*

Fig. 2. Changes in the pigments levels during sunflower primary leaf development. Plants were grown under different atmospheric CO2 concentrations: 400 !L L−1 (closedcircles) and 800 !L L−1 (open circles). Data are means ± SD of duplicate determinations from three separate experiments. Asterisks indicate statistically significant differencesamong the CO2 treatments at the indicated times according to Student’s t-test (P < 0.05).

determined by formation of the titanium–hydroperoxide complexaccording to Mukherjee and Choudhuri (1983).

Carbohydrate determinations

Carbohydrates were extracted from the powdered frozen tis-sue in successive steps with different ethanol/water solutionsaccording to Agüera et al. (2006). The supernatants from the cen-trifugations were collected and combined for the analysis of solublesugars, saving the pellets for starch determination. Sucrose, glucoseand fructose were determined according to Outlaw and Tarczynski(1984), Kunst et al. (1984) and Beutler (1984), respectively. Thepellets were resuspended in water and incubated at 100 ◦C for 5 h.Glucose was then released by incubation with "-amylase and amy-loglucosidase, and assayed enzymatically as described above.

C and N determinations

For C and N determinations, leaves were ground to a homoge-neous powder with an Eppendorf grinder (Retsch MM301), using2 mL Eppendorf containers and 5-mm diameter glass balls. Prior toanalysis, the samples were dried at 70 ◦C for 24 h. Approximately3 mg of sample was weighed into tin foil containers (2 mm × 5 mm)and analyzed for C and N on a CHN elemental analyzer (InterscienceCE instruments, EA 11110 CHNS-O).

Enzymatic antioxidant activity

For determination of catalase and APX, enzyme extracts wereprepared by freezing the weighed amount of leaf samples in liq-uid nitrogen to prevent proteolytic activity, which was followedby grinding in 0.1 M phosphate buffer at pH 7.5 containing 0.5 mMEDTA and 1 mM ascorbic acid in a 1:10 (w/v) ratio. The homogenatewas passed through four layers of gauze and the filtrate centrifugedat 15,000 × g for 20 min, and the resulting supernatant was used asenzyme source.

Catalase activity was estimated according to Aebi (1983). Thereaction mixture contained 50 mM potassium phosphate (pH 7)

and 10 mM H2O2. After the enzyme was added, hydrogen perox-ide decomposition was monitored via the absorbance at 240 nm(ε = 43.6 mM−1 cm−1).

APX activity was measured with the method of Nakano andAsada (1981). The reaction mixture contained 50 mM phosphatebuffer (pH 7), 1 mM sodium ascorbate and 25 mM H2O2. Followingaddition of ascorbate to the mixture, the reaction was monitoredvia the absorbance at 290 nm (ε = 2.8 mM−1 cm−1).

Statistical analysis

Values are given as the means ± SD of duplicate determina-tions from three separate experiments. All results were statisticallyanalyzed using the Student’s t-test and they were conducted at asignificance level of 5% (P < 0.05).

Results

Some growth-related parameters, such as specific leaf mass(SLM) (referred to as dry weight (DW)), leaf area and soluble proteincontent, were determined in primary leaves of sunflower plantsgrown for 42 days under ambient atmospheric CO2 (400 !L L−1)or elevated CO2 (800 !L L−1) concentrations (Fig. 1). In both treat-ments, leaf area increased up to 32 days, especially in the plantsgrown under elevated CO2 concentrations. SLM referred to as DWpeaked at 22 days in the plants grown under ambient atmosphericCO2 concentrations, but at 16 days in the plants grown underelevated CO2 concentrations, decreasing later during leaf develop-ment in both treatments (Fig. 1A and B). A significant decrease inthe soluble protein content was observed during aging of sunflowerprimary leaves at both CO2 levels (Fig. 1C).

The plants grown in the presence of elevated CO2 concentra-tions exhibited lower chlorophyll a and b contents and carotenoidsthan those grown under ambient atmospheric CO2 conditions(Fig. 2). Leaf aging reduced the photosynthetic pigment contentunder both treatments of CO2. Thus, total chlorophyll contentdecreased by about 65% between 22 and 42 days in plants grown atelevated CO2 concentrations, but only by 46% in those grown under

Capítulo I

35


0

1

2

3

4

5

6

7

8

9

16 22 32 42

(µm

olCO

2m

2s

1 )

Days

CO2

Fixa!o

n

0

0,5

1

1,5

2

2,5

3

3,5

4

16 22 32 42

(mm

olH

2Om

2 s1 )

Days

Tran

spira

!on

B

0

100

200

300

400

16 22 32 42

(mm

olH

2Om

2 s1 )

Days

Stom

atal

Cond

ucta

nce

C

A**

*

*

**

*

*

Fig. 3. CO2 fixation rate, transpiration rate and stomatal conductance during sun-flower primary leaf development. Plants were grown under different atmosphericCO2 concentrations: 400 !L L−1 (closed circles) and 800 !L L−1 (open circles). Dataare means ± SD of duplicate determinations from three separate experiments. Aster-isks indicate statistically significant differences among the CO2 treatments at theindicated times according to Student’s t-test (P < 0.05).

ambient atmospheric CO2 conditions. The most marked decreasewas observed between 22 and 32 days, with 48% chlorophyll lossin plants grown at elevated CO2 concentration compared to 26%chlorophyll loss in control plants (Fig. 2C). Likewise, carotenoidcontent decreased by 25% in plants grown at high CO2 concentra-tions, but only by 20% in those grown under ambient atmosphericCO2 conditions (Fig. 2D).

The carbon dioxide fixation rate was negatively affected byaging, after 22 days, in both treatments (Fig. 3A), being higher inthe plants grown under a CO2 enriched atmosphere throughoutthe whole leaf development period. Elevated CO2 concentra-tion increased the transpiration rate and stomatal conductance,although these parameters decreased during leaf ontogeny (Fig. 3Band C).

We also examined the changes in carbohydrate contents duringaging of sunflower primary leaves in order to identify their poten-tial roles as metabolic signals for senescence. The plants grown atelevated CO2 concentrations exhibited higher contents of starchand soluble sugars (glucose and fructose) throughout developmentthan the control plants (Fig. 4A and B). In both CO2 treatments,the concentrations of soluble sugars increased during leaf aging,but the starch content strongly declined (Fig. 4D). The hexoses(glucose + fructose) to sucrose ratio increased at the beginning ofsenescence especially at elevated CO2 concentrations. This suggeststhat accumulation of hexoses in leaves may play a role in regulat-ing leaf senescence, mainly in the plants grown at elevated CO2concentration (Fig. 4).

C and N elemental analysis revealed that leaf development hasan adverse effect on their contents, which results in an increaseof the C/N ratio (Fig. 5C). However, under elevated CO2 concentra-tions, a more marked accumulation of C in the leaves was observed,resulting in higher C/N ratios during leaf aging than in control plants(Fig. 5).

We also studied the production of H2O2 and the activity ofthe antioxidant enzymes catalase and APX in sunflower leaves.As shown in Fig. 6A, H2O2 production increased with leaf aging,especially under elevated CO2 concentrations, suggesting that highlevels of CO2 may play a role in regulating leaf senescence insunflower plants by increasing ROS production. Catalase and APXactivities increased during early leaf development, reaching theirmaximal levels at 22 days and decreasing later in senescent leaves.Also, these antioxidant enzymatic activities were lower in theplants grown at elevated CO2 concentrations throughout leaf devel-opment (Fig. 6B and C).

Discussion

Leaf surfaces provide the most immediate site of contactbetween plants and the atmosphere. Environmental gases enterleaves primarily through stomata and have the potential to changeplant metabolic processes. Our results indicate that some metabolicprocesses are sensitive to high atmospheric CO2 concentration dur-ing sunflower primary leaf ontogeny. In fact, the plants grownunder elevated CO2 concentrations exhibited more marked growththan control plants, as reflected by the greatest increase in SLM,referred to as DW, in young leaves (Fig. 1A). Hovenden andSchimanski (2000) also found that SLM was increased by elevatedatmospheric CO2 in southern beech (Nothofagus cunninghamii). Leafsize is determined by cell division and expansion, which are con-trolled in a coordinated manner during organogenesis by a complexnetwork of factors, including plant hormones, in response to envi-ronmental cues (Nishimura et al., 2004; Tsukaya, 2006; Riikonenet al., 2010). The presence of elevated atmospheric CO2 concentra-tions may influence both cell division (Kinsman et al., 1997) andexpansion (Taylor et al., 2003; Riikonen et al., 2010). Enhancedcell expansion has been associated with an increase of cell-wallextensibility and the activity of the cell wall loosening enzyme,XET (Ferris et al., 2001). It has been described that some cell-cycleand cell wall-loosening genes (encoding histones, expansin, andXET) show an increased expression in leaves of soybean and Betulapapyrifera growing under a CO2-enriched atmosphere (Gupta et al.,2005; Ainsworth et al., 2006; Druart et al., 2006; Kontunen-Soppelaet al., 2010).

Sunflower plants grown under elevated CO2 concentrationsexhibited lower total chlorophyll (a + b) and carotenoid contentsthan plants grown under ambient CO2. Pigment contents decreasedwith leaf development in both treatments, but especially at ele-vated CO2 concentrations. Thus, the greatest decrease was observedbetween 22 and 32 days, with a loss of chlorophyll of 48% in

Capítulo I

36


0

50

100

150

200

250

300

16 22 32 42

(mgg

1 DW

)

Days

Glu

cose

0

50

100

150

200

250

16 22 32 42

(mgg

1 DW

)

Days

Fruc

tose

0

20

40

60

80

100

120

140

160

16 22 32 42

(mgg

1 DW

)

Days

Sucr

ose

0

50

100

150

200

250

300

16 22 32 42

(mgg

1 DW

)

Days

Star

ch

0

1

2

3

4

5

6

16 22 32 42

(Glu

cose

+Fru

ctos

e)/S

ucro

se

Days

(mgg

1 DW

)

A B

C D

E

*

*

*

*

*

*

*

*

*

* *

Fig. 4. Changes in the contents of glucose, fructose, sucrose, starch and in the hexoses to sucrose ratio during sunflower primary leaf development. Plants were grown underdifferent atmospheric CO2 concentrations: 400 !L L−1 (closed circles) and 800 !L L−1 (open circles). Data are means ± SD of duplicate determinations from three separateexperiments. Asterisks indicate statistically significant differences among the CO2 treatments at the indicated times according to Student’s t-test (P < 0.05).

plants grown under elevated CO2 in comparison with a loss of26% in plants grown under ambient conditions (Fig. 2C). Theseresults suggest that a high CO2 concentration accelerates chloro-phyll degradation, and possibly also leaf senescence. Oxidativestress was previously found to reduce the chlorophyll content ofAster tripolium leaves (Geissler et al., 2009). An important fractionof absorbed light may induce ROS formation when photosyntheticpigments like chlorophyll start to decline. Plants possess enzy-matic and non-enzymatic antioxidant mechanisms to avoid orreduce the effects of ROS on photosynthetic organs (Mittler, 2002;Srivalli and Khanna-Chopra, 2009). Our results indicate that anelevated CO2 concentration reduces the activities of catalase andAPX in sunflower primary leaves (Fig. 6). Leaves of soybean plantsgrown at elevated CO2 concentrations produce more H2O2 thanthose grown at ambient CO2 concentrations (Cheeseman, 2006).Although the specific mechanisms by which CO2 promotes H2O2production are unclear, bicarbonate may interact directly with ironor heme derivates to form complexes with an altered redox poten-tial, thereby facilitating increased production of ROS (Arai et al.,2005). Whereas exposure of C3 plants to elevated CO2 concen-tration can be expected to reduce H2O2 production by hinderingphotorespiratory metabolism in leaves (Noctor et al., 2002), ourresults suggest that exposure of sunflower plants to elevated CO2concentration raises oxidative stress through an increase in H2O2production and a decrease in antioxidant enzyme activities such ascatalase and APX (Fig. 6). Also, elevated CO2 concentrations havebeen found to reduce the formation of antioxidative metabolites

and antioxidant enzyme activities in other plants (Erice et al., 2007;Gillespie et al., 2011). According to Jing et al. (2008), mutationsin the Arabidopsis CPR5/OLD1 gene may cause early senescencethrough deregulation of the cellular redox balance. There are someevidences suggesting that inadequate oxidant and carbonyl groupproduction are intrinsically related to plant aging, and also that lowmitochondrial superoxide dismutase and APX activities may con-tribute to extensive protein carbonylation (Vanacker et al., 2006;Srivalli and Khanna-Chopra, 2009). On the whole, our results sup-port the notion that exposure to elevated CO2 concentration canresult in oxidative stress, as previously reflected in increased pro-tein carbonylation in Arabidopsis and soybean (Qiu et al., 2008).

Elevated CO2 concentration increased photosynthetic CO2 fix-ation in sunflower primary leaves in comparison with ambientCO2 concentrations (Fig. 3A), especially in young leaves (16 and22 days). Stomatal conductance and transpiration rates in sun-flower primary leaves decreased during leaf ontogeny, but theseparameters showed the highest values in the presence of ele-vated CO2 concentrations, especially after 22 days (Fig. 3B and C).The stomatal response to atmospheric changes has been exten-sively studied on a wide variety of species, in which stomatalconductance is usually reduced by elevated CO2 concentrations(Long et al., 2004; Ainsworth and Rogers, 2007). Likewise, sto-matal density decreases (Lake et al., 2002), thereby leading to adecreased transpiration rate and an increased leaf temperature(Long et al., 2004). Although stomata in most species close whenthe CO2 concentration rises beyond certain levels, the response

Capítulo I

37


0

5

10

15

20

25

16 22 32 42

Days

Carb

on/N

itrog

enra!o

0

200

400

600

800

16 22 32 42

Days

Carb

on (

mg

g1

DW

)

0

20

40

60

80

16 22 32 42

Days

Nitr

ogen

(mg

g1

DW

)

A

B

C

**

*

*

**

*

Fig. 5. Changes in the contents of carbon and nitrogen and the C/N ratio during sun-flower primary leaf development. Plants were grown under different atmosphericCO2 concentrations: 400 !L L−1 (closed circles) and 800 !L L−1 (open circles). Dataare means ± SD of duplicate determinations from three separate experiments. Aster-isks indicate statistically significant differences among the CO2 treatments at theindicated times according to Student’s t-test (P < 0.05).

of plants to high CO2 levels varies widely, and some species areeven unaffected (Drake et al., 1997). The absence of a stomatalresponse to atmospheric CO2 may be either genetically determinedor the result of adaptation to an atmosphere with a high rela-tive humidity (Curtis, 1996; Morison, 1998). Elevated atmosphericCO2 concentrations should boost CO2 photosynthetic fixation forat least two purposes, namely: (a) to reduce photorespiration and(b) to enhance substrate binding of rubisco (Long et al., 2004,2006; Ainsworth and Rogers, 2007). In Populus tremuloide and B.papyrifera net photosynthesis increases by 49–73% in the pres-ence of elevated CO2 concentrations, and this additionally raisesthe hexoses to sucrose ratio (Riikonen et al., 2008). Our resultssuggest that elevated CO2 concentrations increase the starch andsoluble sugar contents (glucose and fructose), throughout devel-opment in sunflower primary leaves (Fig. 4). A marked increasein the hexose to sucrose ratio was observed at the beginning ofsenescence, especially at elevated CO2 concentrations, suggestingthat carbon mobilization associated with senescence occurs earlier

0,0

0,5

1,0

1,5

2,0

2,5

16 22 32 42

(Ug

1 DW

)

Days

Cata

lase

ac!v

ity

B

0

5

10

15

20

25

30

16 22 32 42

Asco

rbat

epe

roxi

dase

ac!

vity

Days

(Ug

1 DW

)

0

50

100

150

200

250

300

16 22 32 42

H2O

2

Days

(µm

olg

1D

W)

A

C

* *

*

*

*

**

*

*

*

Fig. 6. Hydrogen peroxide accumulation, and catalase and ascorbate peroxidaseactivities during sunflower primary leaf development. Plants were grown underdifferent atmospheric CO2 concentrations: 400 !L L−1 (closed circles) and 800 !L L−1

(open circles). Data are means ± SD of duplicate determinations from three separateexperiments. Asterisks indicate statistically significant differences among the CO2

treatments at the indicated times according to Student’s t-test (P < 0.05).

and more markedly in plants grown at elevated CO2 concentra-tion. The reason for this increase in soluble sugars may be thatunder a surplus of CO2 high amounts of starch are synthesized inmature, photosynthetically active leaves. Also, this increase couldbe the result of senescence promoting a decline in the functionaland structural integrity of cell membranes, thereby accelerating themembrane lipid catabolism which produces sugars by gluconeoge-nesis (Buchanan-Wollaston et al., 2003b; Lim et al., 2007). Sugarsregulate many metabolic and development processes, and in someof them, hexokinase is involved as a sugar sensor. Hexokinase maybe responsible for sugar-dependent senescence regulation, since itsover-expression inhibits plant growth, decreases photosyntheticactivity and induces senescence rapidly (Wingler et al., 2004).Exposure of cucumber plants to elevated CO2 concentrations waspreviously found to result in a concomitant increase in starch andsoluble sugars in leaves, and a decrease in the nitrate content (Larios

Capítulo I

38


et al., 2001; Agüera et al., 2006). However, the effect of elevated CO2concentrations on hexose accumulation varies between species.Thus, hexoses accumulate in soybean plants (Bunce and Sicher,2001; Rogers et al., 2004; Ainsworth and Long, 2005), whereasglucose and fructose contents in Arabidopsis plants are essentiallysimilar irrespective of the CO2 concentration (Bae and Sicher, 2004).According to Van Doorn (2008), little is known about sugar concen-trations and senescence regulation in different tissues and cells.Sugars may not always be the direct cause of leaf senescence,although there is, in fact, sufficient evidence that sugar signalingplays a role in senescence regulation in a complex network witha variety of other signals, such as those resulting from biotic orabiotic stress (Wingler and Roitsch, 2008). Leaves of variable agehave been found to differ in their response to changes in atmo-spheric CO2 concentrations indicating that the effect of sugars onleaf senescence does not depend on their concentration in a spe-cific cell compartment, but rather on the sugar sensitivity of thecells (Casanova Katny et al., 2005; Wingler et al., 2006). Thus, oldleaves are generally more sensitive to sugars than young, expandingleaves (Araya et al., 2005).

It has previously been suggested that changes in leaf metabolismcaused by elevated CO2 concentrations are related to an altered Nstatus in leaves (Kim et al., 2006; Leakey et al., 2009; Sanz-Sáez et al.,2010). We found that the C/N ratio in sunflower primary leavesincreases with the leaf age, especially at elevated CO2 concentration(Fig. 5). Similar results were previously obtained in soybean leavesgrowing under elevated atmospheric CO2 concentrations (Rogerset al., 2004; Ainsworth et al., 2006). Growth in an atmospherecontaining elevated CO2 concentrations usually results in the accu-mulation of soluble sugars and starch, and in a reduction in nitrogenand rubisco levels (Ainsworth and Long, 2005). Generally, plantsgrown under elevated CO2 concentrations are nitrogen- ratherthat carbon-limited. An imbalanced C/N ratio probably acceler-ates senescence and may increase nitrogen availability by releasingnitrogen and rubisco from old leaves (Wiedemuth et al., 2005;Wingler et al., 2006; Zhu et al., 2009).

In conclusion, this work shows that sunflower leaf senescencecould be promoted by an elevated CO2 concentration, revealing thatthe level of soluble sugars, the C/N ratio and the oxidative statusinteract in a complex manner during leaf ontogeny. It is likely thatsystemic signals produced in plants grown with elevated CO2, leadto an early senescence and a higher oxidation state of the cells ofthese plant leaves.

Acknowledgements

This work was funded by Junta de Andalucía (Grant P07-CVI-02627 and PAI Group BIO-0159) and DGICYT (AGL2009-11290).

References

Aebi HE. Catalase. In: Bergmeyer HU, Grassl M, editors. Methods of enzymatic anal-ysis. Weinheim: Verlag Chemie; 1983. p. 273–86.

Agüera E, Cabello P, de la Haba P. Induction of leaf senescence by low nitro-gen nutrition in sunflower (Helianthus annuus L.) plants. Physiol Plantarum2010;138:256–67.

Agüera E, Ruano D, Cabello P, de la Haba P. Impact of atmospheric CO2 on growth,photosynthesis and nitrogen metabolism in cucumber (Cucumis sativus L.)plants. J Plant Physiol 2006;16:809–17.

Ainsworth EA, Rogers A, Vodkin LO, Walter A, Schurr U. The effects of elevated CO2concentration on soybean gene expression. An analysis of growing and matureleaves. Plant Physiol 2006;142:135–47.

Ainsworth EA, Long SP. What have we learned from 15 years of free-air CO2enrichment (FACE)? A meta-analytic review of the responses of photosyn-thesis, canopy properties and plant production to rising CO2. New Phytol2005;165:351–72.

Ainsworth EA, Rogers A. The response of photosynthesis and stomatal conductanceto rising [CO2]: mechanisms and environmental interactions. Plant Cell Environ2007;30:258–70.

Alscher RG, Donahue JH, Cramer CL. Reactive oxygen species and antioxidants: rela-tionships in green cells. Physiol Plantarum 1997;100:224–33.

Apel K, Hirt H. Reactive oxygen species: metabolism, oxidative stress and signaltransduction. Annu Rev Plant Biol 2004;55:373–99.

Arai H, Berlett BS, Chock PB, Stadtman ER. Effect of bicarbonate on iron-mediatedoxidation of low-density lipoprotein. Proc Natl Acad Sci USA 2005;102:10472–7.

Araya T, Noguchi K, Terashima I. Differences between sink and source leaves incarbohydrate repression of photosynthesis. In: van der Est A, Bruce D, editors.Photosynthesis: fundamental aspects to global perspective. International Soci-ety of Photosynthesis; 2005. p. 660–2.

Asada K. The water-water cycle in chloroplasts: scavenging of active oxygens anddissipation of excess photons. Annu Rev Plant Phys 1999;50:601–39.

Bazzaz FA. The response of natural ecosystems to the rising global CO2 levels. AnnuRev Ecol Syst 1990;2l:167–96.

Bazzaz FA, Fajer EC. Plant life in a CO2-rich world. Sci Am 1992;266:68–74.Beutler HO. d-Fructose. In: Bergmeyer HU, editor. Methods of enzymatic analysis.

Weinheim: Verlag Chemie; 1984. p. 321–7.Bradford MM. A rapid and sensitive method for the quantitation of microgram quan-

tities of protein utilizing the principle of protein-dye binding. Anal Biochem1976;72:248–54.

Bae H, Sicher R. Changes of soluble protein expression and leaf metabolite levels inArabidopsis thaliana grown in elevated atmospheric carbon dioxide. Field CropRes 2004;90:61–73.

Buchanan-Wollaston V, Earl S, Harrison E, Mathas E, Navabpour S, Page T, et al. Themolecular analysis of leaf senescence—a genomics approach. Plant Biotechnol J2003a;1:3–22.

Buchanan-Wollaston V, Wellesbourne HRI, Warwic UK.Thomas B, Murphy DJ, Mur-ray BG, editors. Encyclopedia of applied plant science; 2003b. p. 808–16.

Bunce JA, Sicher RC. Water stress and day-to-day variation in apparent pho-tosynthetic acclimation of field-grown soybeans to elevated carbon dioxideconcentration. Photosynthetica 2001;39:95–101.

Cabello P, Agüera E, de la Haba P. Metabolic changes during natural ageing insunflower (Helianthus annuus L.) leaves: expression and activity of glutaminesynthetase isoforms are regulated differently during senescence. Physiol Plan-tarum 2006;128:175–85.

Cabello P, de la Haba P, González-Fontes A, Maldonado JM. Induction of nitratereductase, nitrite reductase, and glutamine synthetase isoforms in sunflowercotyledons as affected by nitrate, light, and plastid integrity. Protoplasma1998;201:1–7.

Casanova Katny MA, Hoffmann-Thoma G, Schrier AA, Fangmeier A, Jäger HJ, vanBel AJE. Increase of photosynthesis and starch in potato under elevated CO2 isdependent on leaf age. J Plant Physiol 2005;162:429–38.

Cheeseman JM. Hydrogen peroxide concentrations in leaves under natural condi-tions. J Exp Bot 2006;57:2435–44.

Cosgrove DJ. Relaxation in a high-stress environment: the molecular bases of exten-sible cell walls and cell enlargement. Plant Cell 1997;9:1031–41.

Curtis PS. A meta-analysis of leaf gas exchange and nitrogen in trees grown underelevated carbon dioxide. Plant Cell Environ 1996;19:127–37.

De la Mata L, Cabello P, de la Haba P, Agüera E. Metabolic regulation of leaf senes-cence in sunflower (Helianthus annuus L.) plants. In: Nagata T, editor. Senescence.Rijeka: InTech d.o.o; 2012. p. 51–68.

Drake BG, González-Meler MA, Long SP. More efficient plants: a consequence ofrising atmospheric CO2? Annu Rev Plant Phys 1997;48:609–39.

Druart N, Rodríguez-Buey M, Barron-Gafford G, Sjödin A, Bhalerao R, Hurry V.Molecular targets of elevated [CO2] in leaves and stems of Populus deltoides:implications for future tree growth and carbon sequestration. Funct Plant Biol2006;33:121–31.

Erice G, Aranjuelo I, Irigoyen JJ, Sánchez-Díaz M. Effect of elevated CO2, temperatureand limited water supply on antioxidant status during regrowth of nodulatedalfalfa. Physiol Plantarum 2007;130:33–45.

Esterbauer H. Aldehyde products of lipid peroxidation. In: McBrien D, Slater T, edi-tors. Free radicals lipid peroxidation and cancer. Boca Raton: Academic Press;1982. p. 101–28.

Ferris R, Sabatti M, Miglietta F, Mills RF, Taylor G. Leaf area is stimulated in Populusby free air CO2 enrichment (POPFACE), through increased cell expansion andproduction. Plant Cell Environ 2001;24:305–15.

Foyer CH, Harbinson JC. Oxygen metabolism and the regulation of photosyntheticelectron transport. In: Foyer CH, Mullineaux PM, editors. Causes of photooxida-tive stress and amelioration of defense systems in plant. Boca Raton, FL: CRCPress; 1994. p. 1–42.

Fry SC, Smith RC, Renwick KF, Martin DJ, Hodge SK, Matthews KJ. Xyloglucan endo-transglycosylase, a new wall-loosening enzyme activity from plants. Biochem J1992;282:821–8.

Gan S, Amasino RM. Making sense of senescence. Plant Physiol 1997;113:313–9.Geissler N, Hussin S, Koyro HW. Elevated atmospheric CO2 concentration ame-

liorates effects of NaCl salinity on photosynthesis and leaf structure of Astertripolium L. J Exp Bot 2009;60:137–51.

Gillespie KM, Rogers A, Ainsworth EA. Growth at elevated ozone or elevated car-bon dioxide concentration alters antioxidant capacity and response to acuteoxidative stress in soybean (Glycine max). J Exp Bot 2011;62:2667–78.

Gupta P, Duplessis S, White H, Karnosky DF, Martin F, Podila GK. Gene expressionpatterns of trembling aspen trees following long-term exposure to interactingelevated CO2 and tropospheric O3. New Phytol 2005;167:129–42.

Hensel LL, Grbic V, Baumgarten DA, Bleecker AB. Developmental and age-relatedprocesses that influence the longevity and senescence of photosynthetic tissuesin Arabidopsis. Plant Cell 1993;5:553–64.

Capítulo I

39


Hewitt EJ. Sand and water culture methods used in the study of plant nutrition.Commonwealth Bureau of Horticultural and Plantation Crops, East Malling. TechCommun 1966; No. 22.

Hovenden MJ, Schimanski LJ. Genotypic differences in growth and stomatal mor-phology of Southern Beech, Nothofagus cunninghamii, expoxed to depleted CO2concentrations. Aust J Plant Physiol 2000;27:281–7.

IPCC. Climate change. In: Solomon SD, Qin M, Manning Z, Chen M, Marquis KB, AverytM, Tignor, Miller HL, editors. The physical science basis. Contribution of WorkingGroup I to the Fourth Assessment. Report of the Intergovernmental Panel onClimate Change. Cambridge: Cambridge University Press; 2007.

Irigoyen JJ, Emerich DW, Sánchez-Díaz M. Alfalfa leaf senescence induced by droughtstress: photosynthesis, hydrogen peroxide metabolism, lipid peroxidation andethylene evolution. Physiol Plantarum 1992;84:67–72.

Jing HC, Hebeler R, Oeljeklaus S, Sitek B, Stühler K, Meyer HE, et al. Early leafsenescence is associated with an altered cellular redox balance in Arabidopsiscpr5/old1 mutants. Plant Biol 2008;1:85–98.

Johnson SM, Doherty SJ, Croy RRD. Biphasic superoxide generation in potato tubers.A self-amplifying response to stress. Plant Physiol 2003;131:1440–9.

Kim SH, Sicher RC, Bae H, Gitz DC, Baker JT, Timlin DJ, et al. Canopy photosynthesis,evapotranspiration, leaf nitrogen, and transcription profiles of maize in responseto CO2 enrichment. Global Change Biol 2006;12:588–600.

Kinsman EA, Lewis C, Davies MS, Young JE, Francis D, Vilhar B, et al. Elevated CO2stimulates cells to divide in grass meristems: a differential effect in two naturalpopulations of Dactylis glomerata. Plant Cell Environ 1997;20:1309–16.

Kontunen-Soppela S, Parviainen J, Ruhanen H, Brosché M, Keinänen M, ThakurRC, et al. Gene expression responses of paper birch (Betula papyrifera) toelevated CO2 and O3 during leaf maturation and senescence. Environ Pollut2010;158:959–68.

Kunst A, Draeger B, Ziegenhorn J. d-Glucose: UV-methods with hexokinase andglucose-6-phosphate dehydrogenase. In: Bergmeyer HU, editor. Methods ofenzymatic analysis. Weinheim: Verlag Chemie; 1984. p. 163–72.

Lake JA, Woodward FI, Quick WP. Long-distance CO2 signalling in plants. J Exp Bot2002;53:183–93.

Larios B, Agüera E, de la Haba P, Pérez-Vicente R, Maldonado JM. A short-termexposure of cucumber plants to rising atmospheric CO2 increases leaf carbo-hydrate content and enhances nitrate reductase expression and activity. Planta2001;212:305–12.

Leakey ADB, Ainsworth EA, Bernacchi CJ, Rogers A, Long SP, Ort DR. Elevated CO2effects on plant carbon, nitrogen and water relations: six important lessons fromFACE. J Exp Bot 2009;60:2859–76.

Lim PO, Kim HJ, Nam HG. Leaf senescence. Annu Rev Plant Biol 2007;58:115–36.Lim PO, Woo HR, Nam HG. Molecular genetics of leaf senescence in Arabidopsis.

Trends Plant Sci 2003;8:272–8.Long SP, Ainsworth EA, Rogers A, Ort DR. Rising atmospheric carbon dioxide: plants

FACE the future. Annu Rev Plant Biol 2004;55:591–628.Long SP, Zhu XG, Naidu SL, Ort DR. Can improvement in photosynthesis increase

crop yields? Plant Cell Environ 2006;29:315–30.Mittler R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci

2002;7:405–10.Morison JIL. Stomatal response to increased CO2 concentration. J Exp Bot

1998;49:443–52.Mukherjee SP, Choudhuri MA. Implications of water stress-induced changes in the

levels of endogenous ascorbic acid and hydrogen peroxide in Vigna seedlings.Physiol Plantarum 1983;58:166–70.

Nakano Y, Asada K. Hydrogen peroxide is scavenged by ascorbate-specific peroxi-dase in spinach chloroplast. Plant Cell Physiol 1981;22:860–7.

Nishimura C, Ohashi Y, Sato S, Kato T, Tabata S, Ueguchi C. Histidine kinase homologsthat act as cytokinin receptors possess overlapping functions in the regulationof shoot and root growth in Arabidopsis. Plant Cell 2004;16:1365–77.

Nishitani K, Tominaga R. Endo-xyloglucan transferase, a novel class of glycosyltrans-ferase that catalyzes transfer of a segment of xyloglucan molecule to anotherxyloglucan molecule. J Biol Chem 1992;267:21058–64.

Noctor G, Veljovic-Jovanovic S, Driscoll S, Novitskaya L, Foyer CH. Drought and oxida-tive load in the leaves of C3 plants: a predominant role for photorespiration? AnnBot-Lond 2002;89:841–50.

Orendi G, Zimmermann P, Baar C, Zentgraf U. Loss of stress-induced expression ofcatalase3 during leaf senescence in Arabidopsis thaliana is restricted to oxidativestress. Plant Sci 2001;161:301–14.

Ougham H, Hörtensteiner S, Armstead I, Donnison I, King I, Thomas H, et al. Thecontrol of chlorophyll catabolism and the status of yellowing as a biomarker ofleaf senescence. Plant Biol 2008;10:4–14.

Outlaw Jr WH, Tarczynski MC. Sucrose. In: Bergmeyer HU, editor. Methods of enzy-matic analysis. Weinheim: Verlag Chemie; 1984. p. 96–103.

Patterson DT, Flint EP. Implications of increasing carbon dioxide and climate changefor plant communities and competition in natural and managed ecosystems.

In: Kimball BA, Rosenberg NJ, Allen Jr LH, editors. Impact of carbon dioxide,trace gases, and climate change on global agriculture. Madison, WI: SpecialPublication American Society of Agronomy Inc.; 1990. p. 83–110.

Polle A. Dissecting the superoxide dismutase–ascorbate–glutathione-pathway inchloroplasts by metabolic modelling. Computer simulations as a step towardsflux analysis. Plant Physiol 2001;126:445–62.

Pritchard SG, Ju Z, van Santen E, Qiu J, Weaver DB, Prior SA, et al. The influence of ele-vated CO2 on the activities of antioxidative enzymes in two soybean genotypes.Aust J Plant Physiol 2000;27:1061–8.

Procházková D, Wilhelmová N. Leaf senescence and activities of the antioxidantenzymes. Biol Plantarum 2007;51:401–6.

Qiu QS, Huber JL, Booker FL, Jain V, Leakey ADB, Fiscus EL, et al. Increased proteincarbonylation in leaves of Arabidopsis and soybean in response to elevated [CO2].Photosynth Res 2008;97:155–66.

Quirino BF, Noh YS, Himelblau E, Amasino RM. Molecular aspects of leaf senescence.Trends Plant Sci 2000;5:78–282.

Riikonen J, Kets K, Darbah J, Oksanen E, Sober A, Vapaavuori E, et al. Carbon gainand bud physiology in Populus tremuloides and Betula papyrifera grown underlong-term exposure to elevated concentrations of CO2 and O3. Tree Physiol2008;28:243–54.

Riikonen J, Percy KE, Kivimäenpää M, Kubiske ME, Nelson ND, Vapaavuori E, et al.Leaf size and surface characteristics of Betula papyrifera exposed to elevated CO2and O3. Environ Pollut 2010;158:1029–35.

Rogers A, Allen DJ, Davey PA, Morgan PB, Ainsworth EA, Bernacchi CJ, et al. Leafphotosynthesis and carbohydrate dynamics of soybeans grown throughouttheir life-cycle under free-air carbon dioxide enrichment. Plant Cell Environ2004;27:449–58.

Sanz-Sáez A, Erice G, Aranjuelo I, Nogués S, Irigoyen JJ, Sánchez-Díaz M. Photo-synthetic down-regulation under elevated CO2 exposure can be prevented bynitrogen supply in nodulated alfalfa. J Plant Physiol 2010;167:1558–65.

Schneider SH. The greenhouse effect: science and policy. Science 1989;243:771–81.

Srivalli B, Khanna-Chopra R. The developing reproductive “sink” induces oxidativestress to mediate nitrogen mobilization during monocarpic senescence in wheat.Biochem Biophys Res Commun 2004;325:198–202.

Srivalli B, Khanna-Chopra R. Delayed wheat flag leaf senescence due to removalof spikelets is associated with increased activities of leaf antioxidant enzymes,reduced glutathione/oxidized glutathione ratio and oxidative damage to mito-chondrial proteins. Plant Physiol Biochem 2009;47:663–70.

Taylor KE, MacCracken MC. Projected effects of increasing concentrations of carbondioxide and trace gases on climate. In: Kimball BA, Rosenberg NJ, Allen Jr LH,editors. Impact of carbon dioxide, trace gases, and climate change on globalagriculture. Madison, WI: Special Publication American Society of AgronomyInc.; 1990. p. 1–17.

Taylor G, Tricker PJ, Zhang FZ, Alston VJ, Miglietta F, Kuzminsky E. Spatial and tempo-ral effects of free-air CO2 enrichment (POPFACE) on leaf growth, cell expansion,and cell production in a closed canopy of poplar. Plant Physiol 2003;131:177–85.

Tsukaya H. Mechanism of leaf-shape determination. Annu Rev Plant Biol2006;57:477–96.

Van Doorn WG. Is the onset of senescence in leaf cells of intact plants due to low orhigh sugars levels? J Exp Bot 2008;59:1963–72.

Vanacker H, Sandalio LM, Jiménez A, Palma JM, Corpas FJ, Meseguer V, et al. Rolesfor redox regulation in leaf senescence of pea plants grown on different sourcesof nitrogen nutrition. J Exp Bot 2006;57:1735–45.

Wiedemuth K, Muller J, Kahlau A, Amme S, Mock HP, Grzam A, et al. Successive mat-uration and senescence of individual leaves during barley whole plant ontogenyreveals temporal and spatial regulation of photosynthetic function in conjunc-tion with C and N metabolism. J Plant Physiol 2005;162:1226–36.

Wingler A, Marès M, Pourtau N. Spatial patterns and metabolic regulation of photo-synthetic parameters during leaf senescence. New Phytol 2004;161:781–9.

Wingler A, Masclaux-Daubresse C, Fischer AM. Sugars, senescence and ageing inplants and heterotrophic organisms. J Exp Bot 2009;60:1063–6.

Wingler A, Purdy S, MacLean JA, Pourtau N. The role of sugars in integratingenvironmental signals during the regulation of leaf senescence. J Exp Bot2006;57:391–9.

Wingler A, Roitsch T. Metabolic regulation of leaf senescence: interactions of sugarsignaling with biotic and abiotic stress responses. Plant Biol 2008;10:50–62.

Wu Y, Cosgrove DJ. Adaptation of roots to low water potentials by changes in cellwall extensibility and cell wall proteins. J Exp Bot 2000;51:1543–53.

Wustman BA, Oksanen E, Karnosky DF, Noormets A, Isebrands JG, Pregitzer KS, et al.Effects of elevated CO2 and O3 on aspen clones varying in O3 sensitivity: can CO2ameliorate the harmful effects of O3? Environ Pollut 2001;115:473–81.

Zhu C, Zhu J, Zeng Q, Liu G, Xie Z, Tang H, et al. Elevated CO2 accelerates flag leaf senes-cence in wheat due to ear photosynthesis which causes greater ear nitrogen sinkcapacity and ear carbon sink limitation. Funct Plant Biol 2009;36:291–9.

5. CAPÍTULO II

Elevated CO2 concentrations alter nitrogen metabolism and

accelerate senescence in sunflower (Helianthus annuus L.)

plants

Capítulo II

43

303

Leaf senescence is a key developmental step in the life of annual plants. During this senescence process, cells undergo drastic metabolic changes and sequential degeneration of cellular structures, mainly chloroplasts. The main function of leaf senescence is the recycling of nutrients, especially nitrogen re-mobilization, which affects the nitrogen availability (Lim et al. 2007). Agüera et al. (2010) showed that leaf senescence in sunflower plants is accelerated by nitrogen deficiency. Research in this area focused on obtaining new cultivars capable of facing the chang-ing climatic conditions on the grounds that elevated CO2 concentrations affect nitrogen assimilation (Bloom et al. 2010). The rise might be mitigated by crop plants, where photosynthesis converts atmos-pheric CO2 into carbohydrates and other organic compounds. The extent of this mitigation remains uncertain, owing to the complex relationship be-

tween carbon and nitrogen metabolism in plants (Reich et al. 2006). Elevated levels of atmospheric CO2 inhibit photorespiration in C3 plants increasing their photosynthetic efficiency, since carboxilation capacity of ribulose-1-5-biphosphate carboxylase/oxygenase (Rubisco) enzyme is not saturated by the current CO2 concentration (Drake et al. 1997). Moreover, root absorption of NO3

– and NH4+ from the

soil and assimilation of NO3– and NH4

+ into organic nitrogen compounds within plant tissues strongly influence primary productivity in plants. The as-similation of NO3

– involves the sequential conver-sion of NO3

– into NO2–, then into NH4

+, through

sequential reactions catalyzed by nitrate reductase (NR) and nitrite reductase (NiR), respectively. NH4

+, the end-product of NO3

– reduction, is assimilated by glutamine synthetase (GS) (Bernard and Habash 2009). Two different isoforms of GS were indentified

Elevated CO2 concentrations alter nitrogen metabolism and accelerate senescence in sunflower (Helianthus annuus L.) plants

L. De la Mata, P. De la Haba, J.M. Alamillo, M. Pineda, E. Agüera

Department of Botany, Ecology and Plant Physiology, Faculty of Science, University of Cordoba, Cordoba, Spain

ABSTRACT

Elevated CO2 concentrations were found to cause early senescence during leaf development in sunflower (Heli-anthus annuus L.) plants, probably by reducing nitrogen availability since key enzymes of nitrogen metabolism, including nitrate reductase (NR); glutamine synthetase (GS) and glutamate dehydrogenase (GDH), were affected. Elevated CO2 concentrations significantly decreased the activity of nitrogen assimilation enzymes (NR and GS) and increased GDH deaminating activities. Moreover, they substantially rose the transcript levels of GS1 while lower-ing those of GS2. Increased atmospheric CO2 concentrations doubled the CO2 fixation and increased transpiration rates, although these parameters decreased during leaf ontogeny. It can be concluded that elevated atmospheric CO2 concentrations alter enzymes involved in nitrogen metabolism at the transcriptional and post-transcriptional levels, thereby boosting mobilization of nitrogen in leaves and triggering early senescence in sunflower plants.

Keywords: leaf development; GS isoforms; transcript levels

Supported by the Junta de Andalucía, Grants No. P07-CVI-02627 and PAI Group BIO-0159, and by the DGICYT, Project No. AGL2009-11290.

Plant Soil Environ. Vol. 59, 2013, No. 7: 303–308

Capítulo II

44

304

in leaves, namely: cytosolic GS1 and chloroplastic GS2 (McNally and Hirel 1983). The GS1 and GS2 isoenzymes are differently regulated within specific cell types and organs, and in response to different developmental, metabolic and environmental cues (Zozaya-Hinchliffe et al. 2005). In addition to GS, other enzymes play key roles in maintaining carbon and nitrogen balance. Thus, GDH catalyzes the reversible amination/deamination between 2-oxo-glutarate and glutamate. Its physiological role in nitrogen metabolism, however, is controversial (Forde and Lea 2007). Although some evidences suggest that glutamate dehydrogenase (GDH) plays a role in NH4

+ assimilation, many other indicate that GDH functions primarily as a deaminating enzyme (Lea and Miflin 2003).

The purpose of this work was to study the effect of elevated atmospheric CO2 concentration, on sun-flower (Helianthus annuus L.) leaf senescence, with special emphasis on nitrogen metabolism enzymes (NR, GS and GDH) and the expression of GS1 and GS2 transcripts during leaf ageing.

MATERIAL AND METHODS

Sunflower (H. annuus L.) isogenic cultivar HA-89 (Semillas Cargill SA, Seville, Spain) plants culti-vated in a growth chamber with a 16 h photoper-iod (400 µmol/m2/s of photosynthetically active radiation), a day/night regime of 25/19°C and 70/80% relative humidity. Plants were irrigated daily with a nutrient solution containing 10 mmol KNO3 (Hewitt 1966). Plants were grown under the above-described conditions for 8 days and then transferred to different controlled-environment cabinets (Sanyo Gallenkam Fitotron, Leicester, UK) fitted with an ADC 2000 CO2 gas monitor. The plants were kept under ambient CO2 levels (400 µL/L) or elevated CO2 concentration (800 µL/L) for another 34 days. High-purity CO2 was supplied from a compressed gas cylinder (Air Liquid, Seville, Spain). Samples of primary leaves aged 16, 22, 32 or 42 days, were collected 2 h after the start of the light photoperiod. Whole leaves were collected and pooled

in two groups: one was used to measure dry weight (DW), and the other was immediately frozen in liquid nitrogen and stored at –80°C. The frozen plant mate-rial was ground in a mortar pre-chilled with liquid N2 and the resulting powder distributed into small vials that were stored at –80°C until enzyme activity and metabolite determinations. Net CO2 fixation rate, transpiration and stomatal conductance were meas-ured 2 h after the start of photoperiod in attached leaves, using a model CRS068 portable infrared gas analyzer (IRGA) with CIRAS software (USA). Gas exchange rates were determined under 400 µL/L or 800 µL/L CO2 levels. The instrument was adjusted to maintain 150 cm3/min constant flow, 25°C tem-perature, 80% relative humidity and 400 µmol/m2/s lighting inside the leaf chamber. Measurements were made on primary leaves (16, 22, 32 and 42 days) after the IRGA stabilization period, using several plants per treatment. Leaf samples were acclimated in the leaf chamber for 5–10 min and the measurements were carried out during the following 3–5 min. For total organic C and N content determinations, leaves were ground with an Eppendorf grinder (Retsch MM301, New York, USA). Prior to analysis, the samples were dried at 70°C for 24 h. Approximately 3 mg of tissue was weighed into tin foil containers (2 × 5 mm) and analyzed for C and N on a CHN elemental analyzer (Interscience CE instruments, 11110 CHNS-O, EURO EA, Saint Nom, France). Frozen material was homogenized with chilled ex-traction medium (Agüera et al. 2006). The homoge-nate was centrifuged at 8 000 × g at 4°C for 2 min, and enzyme activities were measured immediately using the cleared extract. NR (EC 1.6.6.1) activity was assayed in the absence of Mg2+ to determine total NADH-NR activity, as described by Agüera et al. (2006). GS (EC 6.3.1.2) activity was measured with the transferase assay according to De la Haba et al. (1992). GDH (E.C. 1.4.1.2) deaminating activities were determined spectrophotometrically according to Loyola-Vargas and Sánchez de Jiménez (1984).

Total RNA from primary leaves was purified using the Tri-Reagent (Sigma Aldrich, St. Louis, USA), following the manufacturer’s instructions. Total RNA (2.5 µg) was treated with DNAase (RQ1 RNAase-Free

Gene Accesion number Organism Primers sequences (3'- 5')agggcggtctttccaagtat Forward primertggtacgaccactggcataa Reverse primerccaaagcctattcctggtga Forward primer

caaacacccgatcacaacag Reverse primercttgaccctaagcccattga Forward primerggtttccgcaagtaatcctg Reverse primer

GS2 AF005223 Helianthus annus

Actin FJ487620 Helianthus annus

GS1 AF005032 Helianthus annus

Helianthus annuus

Helianthus annuus

Helianthus annuus

Vol. 59, 2013, No. 7: 303–308 Plant Soil Environ.

Capítulo II

45

305

DNase, Promega) and used to generate first-strand cDNA by Reverse Transcriptase III (Invitrogen) using Oligo dT primer, in a total volume of 20 µL. The cDNA was appropriately diluted and the PCR reactions were done using the specific primers listed in the table below. The identity of the amplified fragments was verified by sequenciation.

Expression analysis was carried out by semi-quantitative PCR using GoTaq Flexi DNA polymer-ase (Promega). Expression levels were normalized using the expression of the housekeeping gene actin as internal control. Gene expression levels were determined by image analysis using Quantity One, version 4.6.3 (BioRad, California, USA) af-ter gel electrophoresis of the PCR products, and referred to the level of expression of actin gene in the same sample.

Values are given as the means ± SD of duplicate determinations from three separate experiments. All results were statistically analyzed using the Student’s t-test and they were conducted at a sig-nificance level of 5% (P < 0.05).

RESULTS AND DISCUSSION

Available evidence indicates that high atmos-pheric CO2 concentrations during leaf ontogeny alter the activity and expression of some enzymes that play a key role in the nitrogen metabolism (NR, GS and GDH) (Figure 1) in sunflower plants. In fact, plants grown under elevated CO2 concen-tration exhibited a significant (P < 0.05) lower NR (Figure 1a) and GS activities (Figure 1b) than those grown under ambient atmospheric CO2 conditions, throughout development. Stitt and Krapp (1999) initially assumed that some plant species will require an increased rate of nitrate assimilation to support an increased plant growth under elevated CO2 concentrations. However, CO2 enrichment was shown to inhibit NO3

– assimila-tion in wheat and Arabidopsis plants (Bloom et al. 2010). NO3

– assimilation is powered by the re-duced form of nicotinamide adenine dinucleotide (NADH). Photorespiration boosts the release of malic acid from chloroplasts and increases the

0

20

40

60

10 20 30 40

NR ac

tivity

(μ

mol

NO

-2 /h

/g D

W)

0

10

20

30

10 20 30 40

(mm

ol γ-

gluta

mil h

idro

xam

ate/

h/ g

DW)

Days

GS a

ctivi

ty

0

50

100

150

200

10 20 30 40

GDH

dea

min

atin

g act

ivity

Days

(μm

ol /h

/ g D

W)

(a) (b)

(c)

NR ac

tivity

(μm

ol N

O2– /h

/g D

W)

GS ac

tivity

(mm

ol γ-

gluta

mil h

ydro

xam

ate/h

/g D

W)

GDH

deam

inat

ing a

ctivi

ty(μ

mol

/h/g

DW

)

Figure 1. Nitrate reductase (NR) (a), glutamine syn-thetase (GS) (b) and glutamate dehydrogenase GDH (c) activities during sunflower primary leaf development. Plants were grown under two atmospheric CO2 concen-trations: 400 µL/L (open circles) and 800 µL/L (closed circles). Data are means ± SD of duplicate determina-tions from three independent experiments. Asterisks indicate statistically significant differences among the CO2 treatments at the indicated times according to the Student’s t-test (P < 0.05). DW – dry weight


Capítulo II

46

306

availability of cytoplasmic NADH (Igamberdiev et al. 2001), which enables the first step of NO3

– assimilation (Quesada et al. 2000). Elevated CO2 atmospheric concentrations reduce photorespira-tion and thereby diminish the amount of NADH available to power NO3

– reduction, which may account for the decreased levels of NR activity observed in sunflower plants grown under el-evated CO2 (Figure 1a). On the other hand, six transporters of the Nar1 family are involved in NO2

– translocation from the cytosol into the chlo-roplast in Chlamydomonas, and some of these transport both NO2

– and HCO3– (Mariscal et al.

2006). Bloom et al. (2002) showed that HCO3–

inhibits NO2– influx into isolated wheat and pea

chloroplasts, indicating that an analogous system is operating in higher plants. A decreased NO2

– influx into the chloroplast might therefore be the result of increased CO2 levels, which may also account for the reduced (P < 0.05) GS activity observed in sunflower plants grown under elevated CO2 con-centrations (Figure 1b). Studies have shown that both the chloroplastic and the cytosolic isoforms of GS are affected by abiotic stress (Bernad and Habash 2009). Our results indicate that elevated CO2 atmospheric concentrations significantly in-crease (P < 0.05) GS1 relative expression (Figure 2a), but decrease (P < 0.05) GS2 transcript levels (Figure 2b), in sunflower leaves. During this senescence pro-cess, cells undergo drastic metabolic changes and sequential degeneration of cellular structures, starting with the chloroplasts. These organelles play a dual role, as a main source for nitrogen and

as a regulator of their own degradation during senescence (Zapata et al. 2005). Increased atmos-pheric CO2 levels may boost processes leading to accelerated senescence in sunflower leaves, including dismantling of chloroplasts, where GS2 operates (McNally and Hirel 1983). Several stud-ies have shown that GS1 isoforms are involved in nitrogen remobilization during leaf senescence in grasses (Swarbreck et al. 2011). In C3 plants leaves, the largest part of the NH4

+ assimilated under ambient CO2 concentration is originated in the process of photorespiration, rather than from de novo assimilation of NO3

– or NH4+ (Stitt

and Krapp 1999) and elevated CO2 concentration decreases photorespiration (Foyer et al. 2009). NH4

+ from photorespiration is assimilated by the GS2 isoform (Lam et al. 1996), which agrees with the low levels of GS2 transcripts found in leaves of the plants grown under elevated CO2 concentra-tions relative to the control (Figure 2b). On the other hand, GDH deaminating activity (Figure 1c) peaked in senescent leaves (42 days) with both treatments; activity values after 22 days were sig-nificantly higher (P < 0.05) at the elevated CO2 concentration (Figure 1c). Lea and Miflin (2003) showed that GDH worked primarily in the deami-nation reaction leading to the production of NH4

+ in mitochondria. Therefore, increase in GDH deaminating activity with the increment in CO2 levels and leaf age was expected. These conditions, which boost nitrogen remobilization, are typical of senescence (Lehmann and Ratajcak 2008). Díaz et al. (2008) found induction of gdh2 expression and

0

0.5

1

1.5

2

2.5

3

16 22 32 42

GS1 (

relat

ive ex

pres

sion

level)

Days

0

0.2

0.4

0.6

0.8

1

1.2

16 22 32 42

GS2 (

relat

ive ex

pres

sion

level)

Days

Figure 2. Changes in GS1 (a) and GS2 (b) relative expression level during sunflower primary leaf development. Plants were grown under two atmospheric CO2 concentrations: 400 µL/L (white bars) and 800 µL/L (black bars). Data are means ± SD of duplicate determinations from three independent experiments. Asterisks indicate statistically significant differences among the CO2 treatments at the indicated times according to the Student’s t-test (P < 0.05)

(a) (b)


Capítulo II

47

307

GDH activity with ageing in Arabidopsis, which suggests that GDH participates in amino acid degradation and nitrogen recycling in this plant.

As can be seen from Table 1, the elevated CO2 concentrations significantly (P < 0.05) increased photosynthetic and transpiration rates. In con-trast, stomatal conductance only showed significant differences in 32 days-old leaves, although these parameters decreased during ageing of sunflower primary leaves. The stomatal response to atmos-pheric changes was extensively studied on a wide variety of species. Although stomata in most species close when the CO2 concentration rises beyond certain levels, the response of plants to high CO2 levels varies widely, and some species are even unaffected (Drake et al. 1997, Larios et al. 2004). The absence of a stomatal response to atmospheric CO2 may be either genetically determined or the result of adaptation to an atmosphere with a high relative humidity (Morison 1998). Larios et al. (2004) found that exposure of sunflower leaves to increasing CO2 concentrations caused concomitant increases in photosynthetic CO2 assimilation and soluble sugars and reduction in nitrate content. Elevated levels of atmospheric CO2 were previously reported to decrease photorespiration rates in C3 plants and to potentially increase their photosyn-thetic efficiency as a result (Long et al. 2006). In our plants, the elevated CO2 concentration led to an increased (P < 0.05) C:N ratio during ageing of sunflower primary leaves (Table 1). Consequently, an increase in atmospheric CO2 concentrations alters carbon and nitrogen contents, and leads to a gradual nitrogen limitation by which leaves accumulate carbohydrates faster than the plants can acquire nitrogen, thereby causing the nitrogen contents

of leaves to decrease (Reich et al. 2006). Urban et al. (2012) found that elevated CO2 treatment re-sulted in decrease of the Rubisco content in Picea abies, however, higher proportion of Rubisco are present in its active carbamylated Rubisco forms in comparison to ambient CO2 plants. In these plants, the Rubisco content linearly correlates with leaf nitrogen content, irrespective of CO2 concentration treatments. Limited nitrogen availability leads to early senescence and increases the oxidation state of cells in sunflower leaves (Agüera et al. 2010, De la Mata et al. 2012). In addition, according to Schildhauer et al. (2008), the supply of nitrogen can reverse senescence by altering the expression of genes coding for plastidic GS.

In conclusion, elevated atmospheric CO2 con-centrations during leaf development in sunflower (H. annuus L.) lead to early senescence through a decrease in nitrogen availability resulting from the effects of key enzymes of nitrogen metabo-lism on transcriptional (GS1 and GS2) and post-transcriptional levels (NR, GS and GDH).

REFERENCES

Agüera E., Cabello P., De la Haba P. (2010): Induction of leaf senescence by low nitrogen nutrition in sunflower (Helianthus annuus L.) plants. Physiologia Plantarum, 138: 256–267.

Agüera E., Ruano D., Cabello P., De la Haba P. (2006): Impact of atmospheric CO2 on growth, photosynthesis and nitrogen metabolism in cucumber (Cucumis sativus L.) plants. Journal of Plant Physiology, 163: 809–817.

Bernard S.M., Habash D.Z. (2009): The importance of cytosolic glutamine synthetase in nitrogen assimilation and recycling. New Phytologist, 182: 608–620.

Table 1. CO2 fixation rate, transpiration rate, stomatal conductance and C:N ratio during sunflower primary leaf development. Plants were grown under different atmospheric CO2 concentrations: CO2 ambient (400 µL/L) and CO2 elevated (800 µL/L)

DaysCO2 fixation

(µmol CO2/m2/s)Transpiration

(mmol H2O/m2/s)Stomatal conductance

(mmol H2O/m2/s) C:N ratio

ambient elevated ambient elevated ambient elevated ambient elevated16 3.0 ± 0.4 6.8 ± 1.0* 3.2 ± 0.3 3.2 ± 0.4 345.3 ± 5.1 305.7 ± 43.0 8.0 ± 0.7 9.0 ± 0.7*22 3.4 ± 0.2 7.5 ± 1.1* 1.8 ± 0.1 2.3 ± 0.1* 181.0 ± 7.4 208.0 ± 36.9 8.2 ± 0.1 11.6 ± 2.0*32 2.5 ± 0.5 4.5 ± 0.9* 1.1 ± 0.2 1.9 ± 0.2* 81.8 ± 9.0 160.1 ± 33.7* 11.3 ± 1.1 14.0 ± 1.8*42 1.2 ± 0.2 3.0 ± 0.4* 1.1 ± 0.1 1.4 ± 0.1* 78.5 ± 2.0 95.1 ± 9.0 12.4 ± 0.9 18.3 ± 1.5*

Data are means ± SD of duplicate determinations from three independent experiments. Asterisks indicate statisti-cally significant differences among the CO2 treatments at the indicated times according to Student’s t-test (P < 0.05)


Capítulo II

48

308

Bloom A.J., Burger M., Rubio Asensio J.S., Cousins A.B. (2010): Carbon dioxide enrichment inhibits nitrate assimilation in wheat and Arabidopsis. Science, 328: 899–903.

Bloom A.J., Smart D.R., Nguyen D.T., Searles P.S. (2002): Nitro-gen assimilation and growth of wheat under elevated carbon dioxide. Proceeding of the National Academic of Science of the Unites States of America, 99: 1730–1735.

De la Haba P., Cabello P., Maldonado J.M. (1992): Glutamine-synthetase isoforms appearing in sunflower cotyledons during germination. Effects of light and nitrate. Planta, 186: 577–581.

De la Mata L., Cabello P., De la Haba P., Agüera E. (2012): Growth under elevated atmospheric CO2 concentration accelerates leaf senescence in sunflower (Helianthus annuus L.) plants. Journal of Plant Physiology, 169: 1392–1400.

Díaz C., Lemaitre T., Christ A., Azzopardi M., Kato Y., Sato F., Morot-Gaudry J.F., Dily F.L., Masclaux-Daubresse C. (2008): Nitrogen recycling and remobilization are differentially con-trolled by leaf senescence and development stage in Arabidopsis under low nitrogen nutrition. Plant Physiology, 147: 1437–1449.

Drake B.G., González-Meler M.A., Long S.P. (1997): More ef-ficient plants: A consequence of rising atmospheric CO2? An-nual Review of Plant Physiology and Plant Molecular Biology, 48: 609–639.

Forde B.G., Lea P.J. (2007): Glutamate in plants: Metabolism, regulation and signalling. Journal of Experimental Botany, 58: 2339–2358.

Foyer C.H., Bloom A.J., Queval G., Noctor G. (2009): Photores-piratory metabolism: Genes, mutants, energetics, and redox signaling. Annual Review of Plant Biology, 60: 455–484.

Igamberdiev A.U., Bykovaa N.V., Leab P.J., Gardeströma P. (2001): The role of photorespiration in redox and energy balance of photosynthetic plant cells: A study with a barley mutant deficient in glycine decarboxylase. Physiologia Plantarum, 111: 427–438.

Lam H.M., Coschigano K.T., Oliveira I.C., Melo-Oliveira R., Coruzzi G.M. (1996): The molecular-genetics of nitrogen as-similation into amino acids in higher plants. Annual Review of Plant Physiology and Plant Molecular Biology, 47: 569–593.

Larios B., Agüera E., Cabello P., Maldonado J.M., De la Haba P. (2004): The rate of CO2 assimilation controls the expression and activity of glutamine synthetase through sugar formation in sunflower (Helianthus annuus L) leaves. Journal of Experi-mental Botany, 55: 69–75.

Lea P.J., Miflin B.J. (2003): Glutamate synthase and the synthesis of glutamate in plants. Plant Physiology and Biochemistry, 41: 555–564.

Lehmann T., Ratajczak L. (2008): The pivotal role of glutamate dehydrogenase (GDH) in the mobilization of N and C from

storage material to asparagine in germinating seeds of yellow lupine. Journal of Plant Physiology, 165: 149–158.

Lim P.O., Kim H.J., Nam H.G. (2007): Leaf senescence. Annual Review of Plant Biology, 58: 115–136.

Long S.P., Zhu X.G., Naidu S.L., Ort D.R. (2006): Can improve-ment in photosynthesis increase crop yields? Plant, Cell and Environment, 29: 315–330.

Loyola-Vargas V.M., de Jiménez E.S. (1984): Differential role of glutamate dehydrogenase in nitrogen metabolism of maize tissues. Plant Physiology, 76: 536–540.

McNally S., Hirel B. (1983): Glutamine synthetase isoforms in higher plants. Physiologie Vegetale, 21: 761–774.

Mariscal V., Moulin P., Orsel M., Miller A.J., Fernández E., Galván A. (2006): Differential regulation of the Chlamydomonas Nar1 gene family by carbon and nitrogen. Protist, 157: 421–433.

Morison J.I.L. (1998): Stomatal response to increased CO2 con-centration. Journal of Experimental Botany, 49: 443–452.

Quesada A., Gómez-García I., Fernández E. (2000): Involvement of chloroplast and mitochondria redox valves in nitrate as-similation. Trends in Plant Science, 5: 463–464.

Reich P.B., Hungate B.A., Luo Y.Q. (2006): Carbon-nitrogen interactions in terrestrial ecosystems in response to rising atmospheric carbon dioxide. Annual Review of Ecology, Evolu-tion and Systematics, 37: 611–636.

Schildhauer J., Wiedemuth K., Humbeck K. (2008): Supply of nitrogen can reverse senescence processes and affect expression of genes coding for plastidic glutamine synthetase and lysine-ketoglutarate reductase/saccharopine dehydrogenase. Plant Biology, 10: 76–84.

Stitt M., Krapp A. (1999): The interaction between elevated carbon dioxide and nitrogen nutrition: The physiological and molecular background. Plant, Cell and Environment, 22: 583–621.

Swarbreck S.M., Defoin-Platel M., Hindle M., Saqi M., Habash D.Z. (2011): New perspectives on glutamine synthetase in grasses. Journal of Experimental Botany, 62: 1511–1522.

Urban O., Hrstka M., Zitová M., Holišová P., Sprtová M., Klem K., Calfapietra C., De Angelis P., Marek M.V. (2012): Effect of season, needle age and elevated CO2 concentration on photo-synthesis and Rubisco acclimation in Picea abies. Plant Physiol-ogy and Biochemistry, 58: 135–141.

Zapata J.M., Guéra A., Esteban-Carrasco A., Martín M., Sabater B. (2005): Chloroplasts regulate leaf senescence: Delayed se-nescence in transgenic ndhF-defective tobacco. Cell Death and Differentiation, 12: 1277–1284.

Zozaya-Hinchliffe M., Potenza C., Ortega J.L., Sengupta-Gopalan C. (2005): Nitrogen and metabolic regulation of the expression of plastidic glutamine synthetase in alfafa (Medicago sativa). Plant Science, 168: 1041–1052.

Received on January 27, 2013Accepted on May 17, 2013

Corresponding author:

Dr. Eloísa Agüera Buendía, University of Cordoba, Faculty of Science, Department of Botany, Ecology and Plant Physiology, Área de Fisiología Vegetal, Campus de Rabanales, edificio Celestino Mutis (C4), E-14071 Cordoba, Spainphone: + 34 957 218 367, fax + 34 957 211 069, e-mail: [email protected]


6. CAPÍTULO III

Study of the senescence process in primary leaves of sunflower

(Helianthus annuus L.) plants under two different light intensities

Capítulo III

51

DOI: 10.1007/s11099-013-0001-x PHOTOSYNTHETICA 51 (1): 85-94, 2013

85

Study of the senescence process in primary leaves of sunflower (Helianthus annuus L.) plants under two different light intensities L. DE LA MATA, P. CABELLO, P. DE LA HABA, and E. AGÜERA+ Departamento de Botánica, Ecología y Fisiología Vegetal, Área de Fisiología Vegetal, Facultad de Ciencias, Universidad de Córdoba, Campus de Rabanales. Edificio Celestino Mutis (C4), E-14071 Córdoba, Spain* Abstract Different parameters that vary during leaf development may be affected by light intensity. To study the influence of different light intensities on primary leaf senescence, sunflower (Helianthus annuus L.) plants were grown for 50 days under two photon flux density (PFD) conditions, namely high irradiance (HI) at 350 Pmol(photon) m–2 s–1 and low irradiance (LI) at 125 Pmol(photon) m–2 s–1. Plants grown under HI exhibited greater specific leaf mass referred to dry mass, leaf area and soluble protein at the beginning of the leaf development. This might have resulted from the increased CO2 fixation rate observed in HI plants, during early development of primary leaves. Chlorophyll a and b contents in HI plants were lower than in LI plants in young leaves. By contrast, the carotenoid content was significantly higher in HI plants. Glucose concentration increased with the leaf age in both treatments (HI and LI), while the starch content decreased sharply in HI plants, but only slightly in LI plants. Glucose contents were higher in HI plants than in LI plants; the differences were statistically significant (p<0.05) mainly at the beginning of the leaf senescence. On the other hand, starch contents were higher in HI plants than in LI plants, throughout the whole leaf development period. Nitrate reductase (NR) activity decreased with leaf ageing in both treatments. However, the NR activation state was higher during early leaf development and decreased more markedly in senescent leaves in plants grown under HI. GS activity also decreased during sunflower leaf ageing under both PFD conditions, but HI plants showed higher GS activities than LI plants. Aminating and deaminating activities of glutamate dehydrogenase (GDH) peaked at 50 days (senescent leaves). GDH deaminating activity increased 5-fold during the leaf development in HI plants, but only 2-fold in LI plants. The plants grown under HI exhibited considerable oxidative stress in vivo during the leaf senescence, as revealed by the substantial H2O2 accumulation and the sharply decrease in the antioxidant enzymes, catalase and ascorbate peroxidase, in comparison with LI plants. Probably, systemic signals triggered by a high PFD caused early senescence and diminished oxidative protection in primary leaves of sunflower plants as a result. Additional key words: antioxidant enzymes; ascorbate peroxidase; catalase; glutamate dehydrogenase; glutamine synthetase; hexose; nitrite reductase; irradiance; nitrate reductase; plant; reactive oxygen species; senescence; sunflower; superoxide dismutase. Introduction Leaf senescence is a highly regulated and programmed degeneration process that is controlled by multiple deve-lopmental and environmental signals (Lim et al. 2003). Senescence is not only a degenerative process, but also a recycling process whereby nutrients are translocated from

senescing cells to young leaves, developing seeds or storage tissues (Gan and Amasino 1997). Senescence is characterized mainly by cessation of photosynthesis, degeneration of cellular structures, intensive losses of chlorophylls (Chls), carotenoids (Car) and proteins, and

——— Received 24 January 2012, accepted 24 October 2012. +Corresponding author; tel.: +34957218367, fax +34957211069, e-mail: [email protected] Abbreviations: APX – ascorbate peroxidase; Car – carotenoids; CAT – catalase; Chl – chlorophyll; DTT – dithiothreitol; DM – dry mass; EDTA – ethylenediaminotetraacetic acid; FAD – flavin adenine dinucleotide; GDH – glutamate dehydrogenase; GOGAT – glutamate synthetase; gs – stomatal conductance; GS – glutamine synthetase; GS1 – cytosolic glutamine synthetase; GS2 – chloroplastic glutamine synthetase; HI – high irradiance; LI – low irradiance; NiR – nitrite reductase; NR – nitrate reductase; PFD – photon flux density; PN – net photosynthetic rate; ROS – reactive oxygen species; SLM – specific leaf mass; SOD – superoxide dismutase. Acknowledgements. This work was funded by Junta de Andalucía (Grant P07-CVI-02627 and PAI group BIO-0159) and DGICYT (AGL2009-11290). The authors are grateful to Mr. A. Velasco Blanco for his valuable technical assistance and to Prof. Dr. J. Diz Pérez for the helpful advice on the statistical analysis.

Capítulo III

52

L. DE LA MATA et al.

86

dramatically increased lipid peroxidation (Srivalli and Khanna-Chopra 2004, Agüera et al. 2010). This process can start prematurely by effect of plant exposure to environmental stress or nutrient deprivation (Quirino et al. 2000, Lim et al. 2003, Lim et al. 2007, Wingler et al. 2009, Agüera et al. 2010).

Irradiance and duration of exposure to light are major factors influencing plant growth and development. A very high intensity (about 500–5,000 Pmol m–2 s–1) applied for an extended period leads to irreversible damage of PSII. This phenomenon inhibits photosynthesis and diminishes plant growth (Prasil et al. 1992, Melis 1999, Schansker and van Rensen 1999). To avoid photooxidative damage, plants possess highly efficient photoprotective systems that operate via two primary mechanisms. The first one involves dissipation of excess excitation energy as heat in the antenna pigment complexes of PSII. This process is related to the xanthophyll cycle, by which violaxanthin is de-epoxidized to antheraxanthin and zeaxanthin in the so-called “violaxanthin cycle” or “xanthophyll cycle”. The second photoprotective mechanism involves antioxidant enzymes such as superoxide dismutase (SOD), which converts superoxide anions into H2O2, and catalase and APX, which detoxify the resulting peroxide (Asada 1999, Logan et al. 2006). Plant ageing increases oxidative stress and ROS levels, but this may also reduce antioxidant protection (Buchanan-Wollaston et al. 2003a, Zimmer-mann and Zentgraf 2005, Vanacker et al. 2006). High PFD exposure has been deemed one major cause of oxidative stress in plants (Dat et al. 2000). Some reports describe changes in activity and expression of antioxidant enzymes in response to high PFD stress, albeit to a varying extent depending on the particular plant material and treatment conditions (Hernández et al. 2006, Ariz et al. 2010). The equilibrium between ROS production and scavenging may be altered under different stress

conditions (Srivalli and Khanna-Chopra 2009). Almost all plant stress situations studied to date have

similar effects to natural senescence, and reduce NR, NiR, GOGAT, total GS, and GS2, but increase GDH and GS1 transcripts, proteins, and activity levels (Masclaux et al. 2000, Masclaux-Daubresse et al. 2005, Pageau et al. 2006). NR activity in leaves is rapidly modulated by reversible phosphorylation of NR protein in response to light/dark transitions (Agüera et al. 1999, de la Haba et al. 2001). NR activity decreases under low irradiance in coffee plants (Carelli et al. 2006). According to Cabello et al. (2006), ageing induces oxidative stress in sunflower leaves, having an adverse impact on chloroplastic GS2 and photosynthetic pigments. Ever since GOGAT was discovered, the GS/GOGAT pathway has proved to be the most important process for ammonia assimilation into amino acids (Miflin and Lea 1980). Because of its low affinity for ammonia, GDH is assumed to act as a catabolic enzyme in the deamination of glutamate (Pahlich 1996, Lehmann and Ratajczak 2008). Masclaux-Daubresse et al. (2002) ascribed age-related induction of GDH in a range of plant tissues to either an increase in ammonia content or depletion of carbohydrates, both of which are usually observed during senescence.

The purpose of this work was to study the effect of two PFDs [125 and 350 Pmol(photon) m–2 s–1], with special emphasis on growth, sugar levels, regulation of nitrogen metabolism, enzyme activities, and photo-protection mechanisms during development in primary sunflower (H. annuus L.) leaves. Sunflower has a great agronomical and economical value since it is one of the five most important sources of edible oil in the world (Cantamutto and Poverene 2007). Sunflower oil is also a source of biodiesel (Arzamendi et al. 2008), sunflower plants have an ornamental value and are used for phytoremediation (Mani et al. 2007).

Materials and methods Plant material and growth: Seeds of sunflower (H. an-nuus L.) from the isogenic cultivar HA-89 (Semillas Cargill SA, Sevilla, Spain) were surface-sterilized in 1% (v/v) hypochlorite solution for 15 min. After rinsing in distilled water, the seeds were imbibed for 3 h and then sown in plastic trays containing a mixture of perlite and vermiculite (1:1, v/v). All seeds were germinated and plants were incubated in a chamber under a 16/8 h light/dark cycle and a day/night regime of 25/19ºC temperature and 70/80% relative humidity. Plants were irrigated daily with a nutrient solution containing 10 mM KNO3 (Hewitt 1966).

Two different PFDs (provided by Sylvania F72T12/ CW/VHO, 160 W fluorescent lamps supplemented with Mazda 60 W incandescent bulbs and measured using a model CRS068 portable infrared gas analyser governed via the software CIRAS), HI and LI, were applied over a period of 50 d. At different times (16, 22, 32, 42, and

50 d), primary leaf samples were collected 2 h after the photoperiod start. Entire leaves were excised and pooled in two groups: one was used to measure leaf area and specific leaf mass (SLM) referred to DM, and the other was frozen immediately in liquid nitrogen and stored at –80qC. The frozen plant material was ground in a mortar precooled with liquid N2 and the powder distributed into small vials that were stored at –80qC until enzyme activity and metabolite determinations.

Net CO2 fixation and stomatal conductance were measured on attached leaves, 2 h after the photoperiod start, using a model CRS068 portable infrared gas ana-lyser (MA, USA), governed via the software CIRAS. The instrument was adjusted to have inside the leaf chamber constant conditions of CO2 concentration (360 μl l–1), flow (150 cm3 min–1), leaf temperature (25ºC), relative humidity (80%) and the light intensities used in each treatment (HI and LI). Measurements were made on

Capítulo III

53

SENESCENCE IN SUNFLOWER UNDER DIFFERENT IRRADIANCES

87

primary leaf samples after the stabilization period, using several plants per treatment. Leaf samples were acclimated in the leaf chamber for 5–10 min and measurements were carried out during 3–5 min.

Extraction and activity measurement of NR, GS, and GDH: Frozen material was homogenized with cold extraction medium (4 ml g–1) consisting of 100 mM Hepes-KOH (pH 7.5), 10% (v/v) glycerol, 1% (w/v) polyvinylpolypyrrolidone (PVPP), 0.1% (v/v) Triton, 6 mM DTT, 1 mM EDTA, 0.5 mM phenylmethylsul-phonyl fluoride (PMSF), 25 µM leupeptin, 20 µM flavin adenine dinucleotide (FAD) and 5 µM Na2MoO4. The homogenate was centrifuged at 8,000 × g at 4ºC for 2 min, and enzyme activity measured immediately in the clear extract.

NR (EC 1.6.6.1) activity was determined in the presence and absence of Mg2+. The activation state of NR was calculated as the ratio of its activity in the presence and absence of Mg2+, and expressed as a percentage, as described by Agüera et al. (2006). GS (EC 6.3.1.2) activity was measured with the transferase assay of de la Haba et al. (1992). Finally, GDH (EC 1.4.1.2) aminating and deaminating activities were determined spectrophoto-metrically at 340 nm according to Loyola-Vargas and Sánchez de Jiménez (1984).

Enzyme antioxidant activity: Enzyme extracts for deter-mination of catalase (CAT, EC 1.11.1.6) and APX (EC 1.11.1.11) were prepared by freezing a weighed amount of leaf samples (g) in liquid nitrogen to prevent proteolytic activity, followed by grinding in 10 ml extraction buffer (0.1 M phosphate buffer, pH 7.5, containing 0.5 mM EDTA and 1 mM ascorbic acid). The resulting homogenate was passed through 4 layers of gauze and the filtrate centrifuged at 15,000 × g for 20 min, the supernatant being used as enzyme source.

CAT activity was estimated according to Aebi (1983). The reaction mixture contained 50 mM potassium phosphate (pH 7) and 10 mM H2O2. After enzyme addi-

tion, H2O2 decomposition was monitored spectrophoto-metrically at 240 nm (ε = 43.6 mM–1 cm–1).

APX activity was measured according to Nakano and Asada (1981). The reaction mixture contained 50 mM phosphate buffer (pH 7), 1 mM sodium ascorbate and 25 mM H2O2. After adding of ascorbate to the mixture, the reaction was monitored at 290 nm (ε = 2.8 mM–1

cm–1).

Carbohydrates were extracted from the powdered frozen tissue in successive steps with ethanol/water mixtures in different proportions according to Agüera et al. (2006). The supernatants from each centrifugation were collected and combined to determine soluble sugars, whereas the pellets were used to quantify starch. Sucrose, glucose, and fructose were determined according to Outlaw and Tarczynski (1984), Kunst et al. (1984) and Beutler (1984), respectively. The pellets were resuspended in water and incubated at 100ºC for 5 h. Glucose was then released by

incubation with D-amylase and amyloglucosidase, and assayed enzymatically as described above.

Protein, pigment, and H2O2: Soluble protein was ex-tracted in 50 mM Hepes-KOH (pH 7), 5 mM MgCl2 and 1 mM EDTA, and determined with the Bio-Rad protein assay according to Bradford (1976). Pigments were determined by HPLC in the plant extracts according to Cabello et al. (1998). For H2O2 determination, 1 g of leaf material was ground with 10 ml of cooled acetone in a cold room, and filtered through Whatman filter paper. H2O2 was determined by formation of a titanium-hydroperoxide complex according to Mukherjee and Choudhuri (1983).�

Statistical analysis: Values are given as the means r SD of three separate experiments with duplicate determi-nations. All results were statistically analyzed in a bifactorial model, which considers the effect of the PFD and the cultivation time on the variables using the ANOVA and Tukey’s test and they were conducted at a significance level of 5% (p<0.05).

Results Some growth parameters such as SLM referred to DM, leaf area and soluble protein were determined in primary leaves of sunflower plants grown for 50 d under two PFD regimes, LI and HI (Fig. 1). SLM referred to DM peaked at 22 d in plants grown under both regimes and then decreased by effect of ageing. HI plants exhibited higher SLM referred to DM values than LI plants at the beginning of the growth period (16 and 22 d, Fig. 1A). With both treatments (HI and LI), leaf area increased until day 32, but the values were 24% higher at the beginning of the growth period (16 d) in HI plants (Fig. 1B). In general, HI plants showed greater deve-lopment than LI plants (data not shown). The soluble

protein content exhibited a similar variation pattern in both HI and LI plants, decreasing about 50% during sunflower primary leaf ageing, but the protein levels were about 11% higher in HI plants than in LI plants at 22 and 32 d (Fig. 1C).

Leaf development had a negative effect on photo-synthetic pigment content in both treatments. The chloro-phylls (Chls) a and b contents were lower in HI plants than in LI plants throughout leaf development, with up to 30% decrease in young leaves (Fig. 2A,B). On the contrary, the carotenoid content in HI plants was statistically significantly higher than in LI plants during leaf development period (Fig. 2C).

Capítulo III

54


88

Fig. 1. Changes in specific leaf mass (SLM) referred to dry mass (DM), leaf area and soluble protein during sunflower primary leaf development under LI (■) and HI (□). Data are means r SD of 3 separate experiments with duplicate deter-minations. * – statistically significant differences among the PFD treatments and the cultivation time according to the ANOVA and Tukey’s test (p<0.05). The CO2 fixation rate was negatively affected by leaf ageing in both treatments, but the loss of photosynthetic activity was more marked and occurred earlier in HI plants than in LI plants. Thus, under HI the CO2 fixation rate decreased by about 90% between 22 and 50 d, whereas in LI plants it decreased only about 64% in the same period. Stomatal conductance decreased consider-ably after 22 d, but no statistically significantly diffe-rences were observed between both treatments (Table 1).

We also examined the changes in carbohydrate contents in sunflower primary leaves during ageing in order to identify a potential role as metabolic signals for senescence (Fig. 3). With both treatments (HI and LI), the concentrations of soluble sugars (glucose, fructose and sucrose) increased with the leaf age up to 42 d. By contrast, the starch content decreased very sharply in HI plants during leaf development, but only slightly in LI plants (Fig. 3). Glucose contents were higher in HI plants than in LI plants, these differences were statistically significant (p<0.05), mainly at the beginning of the leaf senescence (32 d) (Fig. 3A). On the other hand, starch

Fig. 2. Changes in the pigment contents during sunflower primary leaf development under LI (■) and HI (□). Data are means r SD of 3 separate experiments with duplicate deter-minations. * – statistically significant differences among the PFD treatments and the cultivation time according to the ANOVA and Tukey’s test (p<0.05). DM – dry mass; Chl – chlorophyll; Car – carotenoids. contents were higher in HI plants than in LI plants, throughout the whole leaf development period (Fig. 3D). NR activity was determined in the presence and absence of Mg2+ in sunflower primary leaves, and the NR activation state was also estimated. As shown in Table 2, NR activity decreased during leaf development, both in the presence and absence of Mg2+. The decrease was more evident under LI, while under HI it was noted only from 22 day. The NR activation state diminished in senescent leaves with both treatments. However, in the HI plants the NR activation state was higher, and it also decreased more sharply during leaf ageing, than in LI plants (Table 2).

GS activity also declined during leaf ageing, and it showed higher values in HI plants (Fig. 4). On the contrary, GDH aminating and deaminating activities (Table 3) peaked in senescent leaves (50 d) and higher values were noted in LI compared with HI. However, the GDH deaminating activity increased 5-fold during leaf

Capítulo III

55


89

Table 1. Net photosynthetic rate (PN) and stomatal conductance (gs) during sunflower primary leaf development under LI and HI.

Data are means r SD of 3 separate experiments with duplicate determinations.!* – statistically significant differences among the PFD

treatments and the cultivation time according to the ANOVA and Tukey’s test (p<0.05).

Time [d] PN [µmol(CO2) m–2

s–1

] gs [mmol(H2O) m–2

s–1

]

LI HI LI HI

16 2.63 ± 0.25 5.06 ± 0.76* 570.25 ± 24.24 550.46 ± 28.87

22 3.40 ± 0.37 5.76 ± 0.80* 620.67 ± 2.42 615.50 ± 5.10

32 3.37 ± 0.30 2.00 ± 0.02* 351.67 ± 2.21 355.30 ± 0.25

42 1.43 ± 0.12 0.66 ± 0.06 30.67 ± 2.03 10.94 ± 0.20

50 1.23 ± 0.12 0.60 ± 0.36 16.56 ± 0.54 6.67 ± 0.77

development in HI plants, but only 2-fold in LI plants.

We also studied H2O2 production and the activity of

CAT and APX in sunflower leaves. As shown in Fig. 5A,

the production of H2O2 increased considerably with leaf

ageing. After 22 d, the H2O2 levels in HI plants were

higher than in LI plants, these differences were statis-

tically significant (p<0.05). CAT and APX activities rose

during early leaf development and decreased in senescent

leaves (42 and 50 d). This decline in the activity of the

antioxidant enzymes was more marked, about 40%, in HI

plants (Fig. 5B,C).

Discussion Our results showed that in primary leaves of sunflower

(H. annuus L.) plants some metabolic processes, like

carbon and nitrogen metabolism and susceptibility to

oxidative stress, were sensitive to irradiance. In fact, we

found HI to increase significantly leaf area, SLM referred

to DM, and soluble protein content at the beginning of

the leaf development (Fig. 1). This might be a result of

the increased photosynthetic capacity observed in HI

plants during early development of primary leaves. At

later stages, the photosynthetic rate decreased faster in HI

plants than in LI plants (Table 1). We have also found a

decrease in soluble protein content during leaf develop-

ment (Fig. 1C) that could be caused by strong degra-

dation of chloroplast proteins during senescence, as

reported by Martínez et al. (2008). On the other hand,

changes in the protein content can reflect alterations in

the distribution of N and C compounds as a consequence

of more efficient N mobilization during senescence (Díaz

et al. 2008).

Leaf development had a negative effect on photo-

synthetic pigment content of sunflower plants, in both

treatments. The content of Chls a and b was lower in HI

plants than in LI plants throughout leaf development,

with up to 30% decrease in young leaves (Fig. 2A,B). Plants can avoid excessive light absorption by, e.g.,

reducing Chl production, adopting a steep inclination or

reflecting incident light (Adams et al. 2004, Baig et al. 2005, Demmig-Adams and Adams 2006). The loss of

Chls is typical of leaf senescence and may be used as an

indicator of this phenomenon (Yoo et al. 2003, Guo and

Gan 2005, Ougham et al. 2008). Astolfi et al. (2001) also

observed a decrease in Chls content and suggested that

high PFD induces premature senescence and increases the

senescence rate. The CO2 fixation rate in HI plants might

have no correlation with Chl content. The higher net

photosynthetic rate (PN) observed in young leaves (16

and 22 d) in HI plants (Table 1), could be explained by a

greater Rubisco content (Ariz et al. 2010) and also as a

consequence of more efficient penetration of incident

radiation into the leaves with lower Chls content

(Radochová and Tichá 2008). The Car content of primary

leaves in sunflower plants grown under both PFD used in

this work revealed that HI plants contained more Car than

LI plants (Fig. 2C). This suggests that plants can

synthesize large amounts of Car as an adaptative strategy

to protect their photosynthetic machinery when subjected

to high PFD (Behera and Choudhury 2001, 2003;

Lichtenthaler 2007).

The concentration of soluble sugars increased up to

42 d in both treatments, with a slight decrease in glucose

and sucrose contents in more senescent leaves (50 d). On

the other hand, the starch content decreased, especially in

HI plants (Fig. 3). Interestingly, our results show a

significant accumulation of glucose and starch in HI

plants in comparison with LI plants. Glucose contents

were statistically significant mainly at the beginning of

the leaf senescence (Fig. 3A). The accumulation of

glucose could not be directly related to photosynthetic

activity because pigment contents and CO2 fixation rates

decreased during leaf ageing (Figs. 2, 3; Table 1). It could

be rather due to starch hydrolysis, especially in HI plants

(Fig. 3D). The increase in soluble sugars, especially

glucose, might also be the result of senescence promoting

a decline in the functional and structural integrity of cell

membranes, thereby accelerating the membrane lipid

catabolism which produces sugars by gluconeogenesis

(Buchanan-Wollaston et al. 2003b, Lim et al. 2007).

Accumulation of soluble sugars at the beginning of

senescence has been described in various plants, but

changes are not clearly associated with leaf development

Capítulo III

56


90

Fig. 3. Changes in the contents of glucose, fructose, sucrose and

starch during sunflower primary leaf development under LI (■)

and HI (□). Data are means r SD of 3 separate experiments with

duplicate determinations. * – statistically significant differences

among the PFD treatments and the cultivation time according to

the ANOVA and Tukey’s test (p<0.05). DM – dry mass.

and may vary depending on the plants lines (Díaz et al. 2005, Wingler et al. 2006, Agüera et al. 2010). In fact,

leaf senescence is a plastic process that can be triggered

by a variety of external and internal factors (Buchanan-

Wollaston et al. 2003a, Wingler et al. 2006, Masclaux-

Daubresse et al. 2007,Wingler et al. 2009). Ono et al. (2001) have shown that shading leaves of sunflower or

bean reduces their sugar contents and delays senescence,

which suggests that the carbohydrate accumulation

induces leaf senescence. It has been suggested a role of

hexose accumulation in ageing leaves as a signal for

either senescence initiation or acceleration in annual

plants (Masclaux et al. 2000, Moore et al. 2003, Díaz et al. 2005, Masclaux-Daubresse et al. 2005, Parrot et al. 2005, Pourtau et al. 2006, van Doorn 2008, Wingler and

Roitsch 2008, Agüera et al. 2010).

Nitrogen metabolism in old source leaves is charac-

terized by progressive hydrolysis of stromal proteins and

degradation of chloroplasts (Masclaux et al. 2000,

Hörtensteiner and Feller 2002). We found that NR

activity in the presence or absence of Mg2+

, as well as the

activation state of NR, decreased during leaf ageing for

both HI and LI plants. However, in HI plants, activation

state of NR increased during early leaf development, and

then decreased drastically during senescence (Table 2).

De la Haba et al. (2001) previously found that both

activity and activation state of NR in cucumber plants

raise with high light intensity and diminish with darkness,

and they ascribed this NR regulation effect to a potential

phosphorylation/dephosphorylation mechanism. Since the

main metabolic process in leaf senescence involves

nutrient remobilization, ammonium should! be rapidly

assimilated into amino acids via GS/GOGAT to avoid

deleterious effects and to supply nitrogenous forms

suitable for source–sink transport (Masclaux-Daubresse

et al. 2006). Our results revealed that GS activity

decreased during sunflower leaf ageing under both irradi-

ance regimes, and that HI plants showed the highest GS

activities (Fig. 4). The effects of light on the expression

of genes coding for chloroplastic isoform GS2 have been

tested by Oliveira and Coruzzi (1999). They found that

chloroplastic isoform GS2 is induced by light or by

carbon metabolites such as sucrose. GS activity is known

Table 2. NR activity (assayed without and with Mg2+) and activation state of NR during sunflower primary leaf development under LI

and HI. Data are means r SD of 3 separate experiments with duplicate determinations. * – statistically significant differences among

the PFD treatments and the cultivation time according to the ANOVA and Tukey’s test (p<0.05).

LI HI

Time [d] NR activity [μmol(NO2–) h–1 g–1(DM)] NR activation NR activity [μmol(NO2

–) h–1 g–1(DM)] NR activation

Assay - Mg2+ Assay + Mg2+ state [%] Assay - Mg2+ Assay + Mg2+ state [%]

16 64.98 ± 0.21 24.88 ± 0.21 38.0 52.57 ± 2.82* 34.95 ± 0.88* 66.5

22 54.94 ± 1.04 18.05 ± 0.26 32.9 58.59 ± 0.67 38.76 ± 0.83* 66.2

32 47.29 ± 0.36 13.03 ± 0.36 27.5 23.88 ± 0.15* 6.60 ± 0.26* 27.7

42 14.17 ± 0.1 4.65 ± 0.05 32.8 21.45 ± 0.15* 5.53 ± 0.15* 24.9

50 11.18 ± 0.57 2.06 ± 0.11 18.5 4.02 ± 0.36* 0.55 ± 0.05* 13.7

Capítulo III

57


91

Table 3. Glutamate dehydrogenase (GDH) aminating and deaminating activities during sunflower primary leaf development under LI

and HI. Data are means r SD of 3 separate experiments with duplicate determinations. * – statistically significant differences among

the PFD treatments and the cultivation time according to the ANOVA and Tukey’s test (p<0.05).

Time [d] GDH activity [μmol h–1

g–1

(DM)]

Aminating Deaminating

LI HI LI HI

16 85.0 ± 4.6 48.5 ± 3.4*

99.5 ± 3.4 38.8 ± 3.7*

22 233.0 ± 15.5 80.1 ± 7.1*

128.6 ± 14.0 67.9 ± 3.7*

32 250.0 ± 37.8 135.9 ± 14.2*

182.0 ± 10.3 89.8 ± 3.8*

42 276.7 ± 14.3 240.2 ± 14.0 196.6 ± 3.4 169.9 ± 10.0*

50 327.7 ± 44.6 235.4 ± 15.2*

216.0 ± 10.3 194.1 ± 7.4

Fig. 4. Changes in the glutamine synthetase (GS) activity during

sunflower primary leaf development under LI (■) and HI (□).

Data are means r SD of 3 separate experiments with duplicate

determinations.! * – statistically significant differences among

the PFD treatments and the cultivation time according to the

ANOVA and Tukey’s test (p<0.05). DM – dry mass.

to decrease during leaf senescence (Masclaux et al. 2000,

Cabello et al. 2006). The loss of GS activity during leaf

development must be mainly due to a progressive decline

in activity and expression of the GS2 isoform since the

cytosolic isoform GS1 increases during sunflower leaf

ageing (Cabello et al. 2006). The greatest increase in

GDH deaminating activity observed in HI plants during

leaf development (5-fold in HI compared with only 2-fold

in LI, Table 3) might be explained assuming that GDH

does not play a role in ammonium assimilation, but rather

it participates in glutamate catabolism (Miflin and

Habash 2002, Masclaux-Daubresse et al. 2006). GDH

activity is also induced in old leaves when nitrogen remo-

bilization is maximal (Masclaux-Daubresse et al. 2006).

Plants grown under HI exhibited considerable oxida-

tive stress in vivo at final stages of leaf development, as

revealed by a significant increase in H2O2 accumulation

and a more marked decrease in antioxidant enzyme

(catalase and APX) activities, in comparison with LI

plants (Fig. 5). Leaf senescence is an oxidative process

that involves degradation of cellular and subcellular

structures and macromolecules, and mobilization of the

resulting degradation products to other plant parts

(Vanacker et al. 2006). Oxidative stress during

senescence may be caused or increased by the loss of

antioxidant enzyme activities (Zimmermann and Zentgraf

2005, Zimmermann et al. 2006, Procházková and

Wilhelmová 2007, Pompelli et al. 2010). Senescence is

also accompanied by an increased ROS production,

Fig. 5. H2O2 accumulation and enzymatic activities of catalase

(CAT) and ascorbate peroxidase (APX) during sunflower

primary leaf development under LI (■) and HI (□). Data are

means r SD of 3 separate experiments with duplicate

determinations. * – statistically significant differences among

the PFD treatments and the cultivation time according to the

ANOVA and Tukey’s test (p<0.05).

Capítulo III

58


92

and one of the reasons for this phenomenon is the imbalance between generation and consumption of electrons in the photosynthetic electron transport chain caused by preferential inhibition of stromal reactions relative to photosystem II photochemistry (Špundová et al. 2003). Inhibition of stromal reactions increases the electron flow to molecular oxygen, thereby causing ROS to accumulate and chloroplast components to be damaged as a result (Špundová et al. 2005, Couée et al. 2006). Susceptibility to oxidative stress depends on the overall balance between production of oxidants and the anti-oxidant capability of cells. High PFD regime was previously found to cause reversible photoinhibition of photosynthesis in pea chloroplasts and to increase ROS potentially regulating the accumulation of mRNA encoding antioxidant enzymes (Hernández et al. 2006.). Changes in an activity and expression of antioxidant enzymes in response to high PFD stress have been reported (Yoshimura et al. 2000, Hernández et al. 2004). High PFD causes early symptoms of senescence during

leaf expansion in tobacco plants (Radochová and Tichá 2008). Our results suggest that HI accelerated senescence in the primary leaf of sunflower plants, probably in order to preserve the functionality of young leaves, and also that one of the reasons for accelerated senescence in HI plants might be the strong cellular oxidation and oxida-tive damage caused by an increased H2O2 accumulation, which might be partially due to an earlier decline of antioxidant enzyme activities in these plants.

In conclusion, our results showed that high PFD caused early senescence in sunflower (H. annuus L.) primary leaves by altering the CO2 fixation rate and the Chl and sugar levels, the activity of key enzymes of nitrogen metabolism (NR, GS, and GDH), and the oxidation status of the plant (accumulation of H2O2 and loss of APX and CAT activities). Systemic signals triggered by a high PFD probably caused early senes-cence and diminished oxidative protection in primary leaves of sunflower plants as a result.

References Adams, W.W., III, Zarter, C.R., Ebbert, V., Demmig-Adams,

B.: Photoprotective strategies of overwintering evergreens. – BioScience 54: 41-49, 2004.

Aebi, H.E.: Catalase. – In: Bergmeyer, H.U., Grassl, M. (ed.): Methods of Enzymatic Analysis. Pp. 273-286. Verlag Chemie, Weinheim 1983.

Agüera, E., Poblete, L., de la Haba, P., Maldonado, J. M.: Light modulation and in vitro effects of adenine nucleotides on leaf nitrate reductase activity in cucumber (Cucumis sativus). – Physiol. Plant. 105: 218-223, 1999.

Agüera, E., Ruano, D., Cabello, P., de la Haba, P.: Impact of atmospheric CO2 on growth, photosynthesis and nitrogen metabolism in cucumber (Cucumis sativus L.) plants. – J. Plant Physiol. 163: 809-817, 2006.

Agüera, E., Cabello, P., de la Haba, P.: Induction of leaf senescence by low nitrogen nutrition in sunflower (Helianthus annuus) plants. – Physiol. Plant. 138: 256-267, 2010.

Ariz, I., Esteban, R., García-Plazaola, J.I., Becerril, J.M. et al.: High irradiance induces photoprotective mechanisms and a positive effect on NH4

+ stress in Pisum sativum L. – J. Plant Physiol. 167: 1038-1045, 2010.

Arzamendi, G., Campo, I., Arguiñarena, E., Sánchez, M., Montes, M., Gandía, L.M.: Synthesis of biodiesel from sunflower oil with silica-supported NaOH catalysts. – J. Chem. Technol. Biotechnol. 83: 862-870, 2008.

Asada, K.: The water-water cycle in chloroplasts: scavenging of active oxygens and dissipation of excess photons. – Annu. Rev. Plant Physiol. Plant Mol. Biol. 50: 601-639, 1999.

Astolfi, S., De Biasi, M.G., Passera, C.: Effects of irradiance-sulphur interactions on enzymes of carbon, nitrogen and sulphur metabolism in maize plants. – Photosynthetica 39: 177-181, 2001.

Baig, M.J., Anand, A., Mandal, P.K., Bhatt, R.K.: Irradiance influences contents of photosynthetic pigments and proteins in tropical grasses and legumes. – Photosynthetica 43: 47-53, 2005.

Behera, R.K., Choudhury, N.K.: Photosynthetic characteristics

of chloroplasts of primary wheat leaves grown under different irradiance. – Photosynthetica 39: 11-15, 2001.

Behera, R.K., Choudhury, N.K.: High irradiance-induced changes in carotenoid composition and increase in non-photochemical quenching of Chl a fluorescence in primary wheat leaves. – J. Plant Physiol. 160: 1141-1146, 2003.

Beutler, H.O.: D-Fructose. – In: Bergmeyer, H.U. (ed.): Methods of Enzymatic Analysis. Pp. 321-327. Verlag Chemie, Weinheim 1984.

Bradford, M.M.: A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye-binding. – Anal. Biochem. 72: 248-254, 1976.

Buchanan-Wollaston, V., Earl, E., Harrison, E., Mathas, E., Navabpour, S., Page. T, Pink, D.: The molecular analysis of leaf senescence – a genomics approach. – Plant Biotechnol. J. 1: 3-22, 2003a.

Buchanan-Wollaston, V., Wellesbourne, H.R.I., Warwick, U.K.: Senescence, leaves. – In: Encyclopedia of Applied Plant Sciences, Elsevier Academic Press. Pp. 808-816, 2003b.

Cabello, P., de la Haba, P., González-Fontes, A., Maldonado, J.M.: Induction of nitrate reductase, nitrite reductase, and glutamine synthetase isoforms in sunflower cotyledons as affected by nitrate, light, and plastid integrity. – Protoplasma 201: 1-7, 1998.

Cabello, P., Agüera, E., de la Haba, P.: Metabolic changes during natural ageing in sunflower (Helianthus annuus) leaves: expression and activity of glutamine synthetase isoforms are regulated differently during senescence. – Physiol. Plant. 128: 175-185, 2006.

Cantamutto, M., Poverene, M.: Genetically modified sunflower release: opportunities and risks. Field Crop. Res. 101: 133-144, 2007.

Carelli, M.L.C., Fahl, J.I., Cochicho J.D.: Aspects of nitrogen metabolism in coffee plants. – Braz. J. Plant Physiol. 18: 9-21, 2006.

Couée, I., Sulmon, C., Gouesbet, G., El Amrani, A.: Involve-ment of soluble sugars in reactive oxygen species balance and

Capítulo III

59


93

responses to oxidative stress in plants. – J. Exp. Bot. 3: 449-459, 2006.

Dat, J., Vandenabeele, S., Vranová, E., Van Montagu, M., Inzè, D., Van Breusegem, F.: Dual action of the active oxygen species during plant stress responses. – Cell. Mol. Life Sci. 57: 779-795, 2000.

de la Haba, P., Cabello, P., Maldonado, J.M.: Glutamine-synthetase isoforms appearing in sunflower cotyledons during germination. Effects of light and nitrate. – Planta 186: 577-581, 1992.

de la Haba, P., Agüera, E., Benítez, L., Maldonado, J.M.: Modulation of nitrate reductase activity in cucumber (Cucumis sativus) roots. – Plant Sci. 161: 231-237, 2001.

Demmig-Adams, B., Adams, W.W., III: Photoprotection in an ecological context: the remarkable complexity of thermal energy dissipation. – New Phytol. 172: 11-21, 2006.

Díaz, C., Purdy, S., Christ, A., Morot-Gaudry, J.F., Wingler, A., Masclaux-Daubresse, C.: Characterization of markers to determine the extent and variability of leaf senescence in Arabidopsis. A metabolic profiling approach. – Plant Physiol. 138: 898-908, 2005.

Díaz, C., Lemaître, T., Christ, A., et al.: Nitrogen recycling and remobilization are differentially controlled by leaf senescence and development stage in Arabidopsis under low nitrogen nutrition. – Plant Physiol. 147: 1437-1449, 2008.

Gan, S., Amasino, R.M.: Making sense of senescence. Molecular genetic regulation and manipulation of leaf senescence. – Plant Physiol. 113: 313-319, 1997.

Guo, Y., Gan, S.: Leaf senescence: signals, execution, and regulation. – Curr. Top. Develop. Biol. 71: 83-112, 2005.

Hernández, J.A., Escobar, C., Creissen, G., Mullineaux, P.M.: Role of hydrogen peroxide and the redox state of ascorbate in the induction of antioxidant enzymes in pea leaves under excess light stress. – Funct. Plant Biol. 31: 359-368, 2004.

Hernández, J.A., Escobar, C., Creissen, G., Mullineaux, P.M.: Antioxidant enzyme in pea plants under high irradiance. – Biol. Plant. 50: 395-399, 2006.

Hewitt, E.J.: Sand and water culture methods used in the study of plant nutrition. – Commonwealth Bureau of Horticultural and Plantation Crops, East Malling. Tech. Commun. No 22, 1966.

Hörtensteiner, S., Feller, U.: Nitrogen metabolism and remobili-zation during senescence. – J. Exp. Bot. 53: 927-937, 2002.

Kunst, A., Draeger, B., Ziegenhorn, J.: D-Glucose: UV-methods with hexokinase and glucose-6-phosphate dehydrogenase. – In: Bergmeyer, H.U. (ed.): Methods of Enzymatic Analysis. Pp. 163-172. Verlag Chemie, Weinheim 1984.

Lehmann, T., Ratajczak, L.: The pivotal role of glutamate dehydrogenase (GDH) in the mobilization of N and C from storage material to asparagine in germinating seeds of yellow lupine. – J. Plant Physiol. 165: 149-158, 2008.

Lichtenthaler, H.K.: Biosynthesis, accumulation and emission of carotenoids, D-tocopherol, plastoquinone, and isoprene in leaves under high photosynthetic irradiance. – Photosynth. Res. 92: 163-179, 2007.

Lim, P.O., Woo, H.R., Nam, H.G: Molecular genetics of leaf senescence in Arabidopsis. – Trends Plant Sci. 8: 272-278, 2003.

Lim, P.O., Kim, H.J., Nam, H.G.: Leaf senescence. – Annu. Rev. Plant Biol. 58: 115-136, 2007.

Logan, B.A. Kornyeyev, D., Hardison, J., Holaday, A.S.: The role of antioxidant enzymes in photoprotection. – Photosynth. Res. 88: 119-132, 2006.

Loyola-Vargas, V.M., Sánchez de Jiménez, E.: Differential role of glutamate dehydrogenase in nitrogen metabolism of maize tissues. – Plant Physiol. 76: 536-540, 1984.

Mani, D., Sharma, B., Kumar, C.: Phytoaccumulation, inter-action, toxicity and remediation of cadmium from Helianthus annuus L. (sunflower). - Bull. Environ. Contam. Toxicol. 79: 71-79, 2007.

Martínez, D.E., Costa, M.L., Guiamet, J.J.: Senescence-associated degradation of chloroplast proteins inside and outside the organelle. – Plant Biol. 10: 15-22, 2008.

Masclaux, C., Valadier, M.H., Brugière, N., Morot-Gaudry, J.F., Hirel, B.: Characterization of the sink/source transition in tobacco (Nicotiana tabacum L.) shoots in relation to nitrogen management and leaf senescence. – Planta 211: 510-518, 2000.

Masclaux-Daubresse, C., Valadier, M.H., Carrayol, E., Reisdorf-Cren, M., Hirel, B.: Diurnal changes in the expres-sion of glutamate dehydrogenase and nitrate reductase are involved in the C/N balance of tobacco source leaves. – Plant Cell Environ. 25: 1451-1462, 2002.

Masclaux-Daubresse, C., Carrayol, E., Valadier, M.H.: The two nitrogen mobilisation- and senescence-associated GS1 and GDH genes are controlled by C and N metabolites. – Planta 221: 580-588, 2005.

Masclaux-Daubresse, C., Reisdorf-Cren, M., Pageau, K. et al.: Glutamine synthetase-glutamate synthase pathway and glutamate dehydrogenase play distinct roles in the sink-source nitrogen cycle in tobacco. – Plant Physiol. 140: 444-456, 2006.

Masclaux-Daubresse, C., Purdy, S., Lemaître, T., Pourtau, N., Taconnat, L., Renou, J. P., Wingler, A.: Genetic variation suggests interaction between cold acclimation and metabolic regulation of leaf senescence. – Plant. Physiol. 143: 434-446, 2007.

Melis, A.: Photosystem-II damage and repair cycle in chloroplasts: what modulates the rate of photodamage in vivo? – Trends Plant Sci. 4: 130-135, 1999.

Miflin, B.J., Lea, P.J.: Ammonium assimilation. – In: Miflin, B.J. (ed.): The Biochemistry of Plants Amino Acids and Derivatives. Pp. 169-202. Academic Press. New York- London – Toronto – Sydney – San Francisco 1980.

Miflin, B.J., Habash, D.: The role of glutamine synthetase and glutamate dehydrogenase in nitrogen assimilation and possibilities for improvement in the nitrogen utilization of crops. – J. Exp. Bot. 53: 979-987, 2002.

Moore, B., Zhou, L., Rolland, F., et al.: Role of the Arabidopsis glucose sensor HXK1 in nutrient, light and hormonal signaling. – Science 300: 332-336, 2003.

Mukherjee, S.P., Choudhuri, M.A.: Implications of water stress-induced changes in the levels of endogenous ascorbic acid and hydrogen peroxide in Vigna seedlings. – Physiol. Plant. 58: 166-170, 1983.

Nakano, Y., Asada, K.: Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. – Plant Cell Physiol. 22: 867-880, 1981.

Oliveira, I.C., Coruzzi, G.M.: Carbon and amino acids recipro-cally modulate the expression of glutamine syntethase in Arabidopsis. – Plant Physiol. 121: 301-310, 1999.

Ono, K., Nishi, Y., Watanabe, A., Terashima, I.: Possible mechanisms of adaptive leaf senescence. – Plant Biol. 3: 234-243, 2001.

Ougham, H., Hörtensteiner, S., Armstead, I., Donnison, I., King, I., Thomas, H., Mur, L.: The control of chlorophyll

Capítulo III

60


94

catabolism and the status of yellowing as a biomarker of leaf senescence. – Plant Biol. 10: 4-14, 2008.

Outlaw, W.H., Jr., Tarczynski, M.C.: Sucrose. – In: Bergmeyer, H.U. (ed.): Methods of Enzymatic Analysis. Pp. 96-103. Verlag Chemie, Weinheim 1984.

Pageau, K., Reisdorf-Cren, M., Morot-Gaudry, J.F., Masclaux-Daubresse, C.: The two senescence-related markers, GS1 (cytosolic glutamine synthetase) and GDH (glutamate dehyd-rogenase), involved in nitrogen mobilization, are differentially regulated during pathogen attack and by stress hormones and reactive oxygen species in Nicotiana tabacum L. leaves. – J. Exp. Bot. 57: 547-557, 2006.

Pahlich, E.: Remarks concerning the dispute related to the function of plant glutamate dehydrogenase: commentary. – Can. J. Bot. 74: 512-515, 1996.

Parrott, D., Yang, L., Shama, L., Fischer, A.M.: Senecence is accelerated, and several proteases are induced by carbon “feast” conditions in barley (Hordeum vulgare L.) leaves. – Planta 222: 989-1000, 2005.

Pompelli, M.F., Martins, S.C.V., Antunes, W.C., Chaves, A.R.M., DaMatta, F.M.: Photosynthesis and photoprotection in coffee leaves is affected by nitrogen and light availabilities in winter conditions. – J. Plant Physiol. 167: 1052-1060, 2010.

Pourtau, N., Jennings, R., Pelzer E. et al..: Effect of sugar-induced senescence on gene expression and implications for the regulation of senescence in Arabidopsis. – Planta 224: 556-568, 2006.

Prášil, O., Adir, N., Ohad, I.: Dynamic of PSII: Mechanism of photoinhibition and recovery process. – In: Baber, J. (ed.): The Photosystems: Structures, Function and Molecular Biology. Pp 295-348. Elsevier, Amsterdam – London – New York – Tokyo 1992.

Procházková, D., Wilhelmová, N.: Leaf senescence and activi-ties of the antioxidant enzymes. – Biol. Plant. 51: 401-406, 2007.

Quirino, B.F., Noh, Y.S., Himelblau, E., Amasino, R.M.: Molecular aspects of leaf senescence. – Trends Plant Sci. 5: 278-282, 2000.

Radochová, B., Tichá, I.: Excess irradiance causes early symp-toms of senescence during leaf expansion in photoauto-trophically in vitro grown tobacco plants. – Photosynthetica 46: 471-475, 2008.

Schansker, G., van Rensen, J.J.S.: Performance of active Photosystem II centers in photoinhibited pea leaves. –Photosynth. Res. 62:175-184, 1999.

Špundová, M., Popelková, H., Ilík, P., et al.: Ultra-structural

and functional changes in the chloroplasts of detached barley leaves senescing under dark and light conditions. – J. Plant Physiol. 160: 1051-1058, 2003.

Špundová, M., Slouková, K., Hunková, M., Nauš, J.: Plant shading increases lipid peroxidation and intensifies senescence-induced changes in photosynthesis and activities of ascorbate peroxidase and glutathione reductase in wheat. – Photosynthetica 43: 403-409, 2005.

Srivalli, B., Khanna-Chopra, R.: The developing reproductive ‘sink’ induces oxidative stress to mediate nitrogen mobili-zation during monocarpic senescence in wheat. – Biochem. Biophys. Res. Commun. 325: 198-202, 2004.

Srivalli, B., Khanna-Chopra, R.: Delayed wheat flag leaf senescence due to removal of spikelets is associated with increased activities of leaf antioxidant enzymes, reduced glutathione/oxidized glutathione ratio and oxidative damage to mitochondrial proteins. – Plant Physiol. Biochem. 47: 663-670, 2009.

Vanacker, H., Sandalio, L.M., Jiménez, A., et al.: Roles for redox regulation in leaf senescence of pea plants grown on different sources of nitrogen nutrition. – J. Exp. Bot. 57: 1735-1745, 2006.

van Doorn, W.G.: Is the onset of senescence in leaf cells of intact plants due to low or high sugar level? – J. Exp. Bot. 59: 1963-1972, 2008.

Wingler, A., Masclaux-Daubresse, C., Fischer, A.M.: Sugars, senescence and ageing in plants and heterotrophic organisms. – J. Exp. Bot. 60: 1063-1066, 2009.

Wingler, A., Purdy, S., MacLean, J.A., Pourtau, N.: The role of sugars in integrating environmental signals during the regu-lation of leaf senescence. – J. Exp. Bot. 57: 391-399, 2006.

Wingler, A., Roitsch, T.: Metabolic regulation of leaf senes-cence: interactions of sugar signalling with biotic and abiotic stress responses. – Plant Biol. 10: 50-62, 2008.

Yoo, S.D., Greer, D.H., Laing, W.A., McManus, M.T.: Changes in photosynthetic efficiency and carotenoid composition in leaves of white clover at different developmental stages. – Plant Physiol. Biochem. 41: 887-893, 2003.

Yoshimura, K., Yabuta, Y., Ishikawa, T., Shigeoka, S.: Expres-sion of spinach ascorbate peroxidase isoenzymes in response to oxidative stresses. – Plant Physiol. 123: 223-234, 2000.

Zimmermann, P., Zentgraf, U.: The correlation between oxida-tive stress and leaf senescence during plant development. – Cell. Mol. Biol. Lett. 10: 515-534, 2005.

Zimmermann, P., Heinlein, C., Orendi, G., Zentgraf, U.: Senes-cence-specific regulation of catalases in Arabidopsis thaliana (L.) Heynh. – Plant Cell Environ. 29: 1049-1060, 2006.

7. CAPÍTULO IV

High temperature promotes early senescence in primary leaves of


Capítulo IV

63

Capítulo IV

64

Capítulo IV

65

Capítulo IV

66

Capítulo IV

67

Capítulo IV

68

Capítulo IV

69

Capítulo IV

70

Capítulo IV

71

Capítulo IV

72

Capítulo IV

73

8. DISCUSIÓN

Discusión

77

En el presente trabajo se han estudiado los cambios fisiológicos y metabólicos que

ocurren en las plantas de girasol durante su desarrollo, bajo diferentes factores ambientales:

elevada concentración de CO2 atmosférico, elevada intensidad lumínica y elevada

temperatura. Para ello, se determinaron los cambios en el contenido en pigmentos

fotosintéticos, asimilación fotosintética de CO2, contenido en carbohidratos, actividades y

niveles de expresión de enzimas del metabolismo del nitrógeno y el estado oxidativo del

tejido vegetal. En general, se ha observado que durante el proceso de desarrollo de la hoja

primaria de girasol se produce un adelanto del proceso de senescencia cuando las plantas se

sometieron, de forma independiente, a elevadas concentraciones de CO2 atmosférico, elevada

irradiancia y elevada temperatura. Los factores ambientales estudiados pueden verse

afectados por el cambio climático en curso y de ahí la importancia del estudio de sus efectos

sobre el desarrollo de la planta.

Este estudio se ha realizado en plantas de girasol debido a la gran importancia del

cultivo, ya que su uso es fundamental en la alimentación humana (semilla o aceite), de

animales (forraje), y también por su valor agronómico y ambiental (Putt 1997; Cantamutto y

Poverene 2007; Mani et al. 2007; Arzamendi et al. 2008).

En el capítulo I, se observó que algunos procesos fisiológicos y metabólicos son

sensibles a la elevada concentración de CO2 (800 µL L-1) durante el desarrollo de la hoja

primaria de girasol. En general, las plantas cultivadas con elevada concentración de CO2

atmosférico presentaron un mayor crecimiento como se refleja en la elevada SLM encontrada

en hojas jóvenes (16 días). Hovenden y Schimanski (2000) también comprobaron en hojas de

Nothofagus cunningahamii, que la SLM incrementaba en respuesta al elevado CO2

atmosférico. El crecimiento de la hoja depende de dos procesos fisiológicos: expansión y

división celular, ambos están controlados de forma coordinada, durante la organogénesis, por

diversos factores endógenos entre los que se encuentran las hormonas vegetales las cuales

responden a señales ambientales (Nishimura et al. 2004; Tsukaya 2006; Riikonen et al.

2010). El incremento de la expansión celular se debe a un aumento de la actividad de la

enzima XET y como consecuencia se produce un incremento de la extensibilidad de la pared

celular (Ferris et al. 2001). Además, se ha descrito en hojas de soja y Betula papyrifera que a

elevados niveles de CO2, se produce un incremento de la expresión de genes que intervienen

en el ciclo celular y en el proceso de fluidificación de la pared celular (Gupta et al. 2005;

Ainsworth et al. 2006; Druart et al. 2006; Kontunen-Soppela et al. 2010).

Discusión

78

Las plantas de girasol cultivadas a elevada concentración de CO2 atmosférico

mostraron menor contenido de clorofila (a y b) y de carotenoides durante la ontogenia de la

hoja primaria. El contenido en pigmentos fotosintéticos disminuyó con el desarrollo de la

hoja tanto a elevado CO2 (800 µL L-1) como a CO2 ambiental (400 µL L-1) siendo esta

respuesta más acentuada a elevada concentración de CO2. Estos resultados sugieren que el

elevado CO2 atmosférico acelera la degradación de clorofilas y posiblemente también la

senescencia de la hoja. Así mismo, los niveles de actividad de algunas enzimas antioxidantes

como la catalasa o la APX se redujeron durante el desarrollo de hojas primarias de plantas de

girasol cultivadas a elevado CO2 al igual que se observó en otras especies (Erice et al. 2007;

Gillespie et al. 2011). Por el contrario, los niveles de H2O2 incrementaron. Estos cambios,

posiblemente determinan un estrés oxidativo en la hoja lo que provoca la degradación de los

pigmentos fotosintéticos. (Geissler et al. 2009). Diferentes estudios han sugerido que la

producción, de forma no adecuada, de grupos oxidantes y carbonilos está relacionada con la

edad de la planta y también que la disminución de las actividades APX y SOD

mitocondriales, pudiendo contribuir a un aumento del proceso de carbonilación de proteínas

(Vanacker et al. 2006; Srivalli y Khanna-Chopra, 2009). En plantas de Arabidopsis y de soja

se observó que el elevado CO2 incrementó el contenido en grupos carbonilos, lo que causó la

perdida de clorofila en la hoja (Qiu et al. 2008). Nuestros resultados sugieren que la

exposición a elevada concentración de CO2 puede provocar un estrés oxidativo en la planta,

lo que podría aumentar la carbonilación de proteínas.

La elevada concentración de CO2 incrementó la velocidad de fijación fotosintética de

CO2, la conductancia estomática y la transpiración. La respuesta estomática de las plantas al

elevado CO2 varía ampliamente entre especies y algunas de ellas pueden no verse afectadas

por este factor (Drake et al. 1997). Esta falta de respuesta estomática al elevado CO2 puede

estar genéticamente determinada o bien ser el resultado de la adaptación a una atmósfera con

elevada humedad relativa (Curtis 1996; Morison 1998). La elevada concentración de CO2

puede incrementar los niveles de fijación fotosintética de CO2 en las plantas, principalmente

de dos formas: a) reduciendo el proceso de fotorrespiración; b) aumentando el sustrato de la

rubisco (Long et al. 2004, 2006; Ainsworth y Rogers 2007). En Populus tremuloide y Betula

papirifera la fotosíntesis neta incrementó entre el 49 y 73% en presencia de elevado CO2 y

esto causó un aumento de la razón hexosas/sacarosa (Riikonen et al. 2008). Nuestros

resultados muestran, al inicio de la senescencia de la hoja, un marcado incremento de la razón

hexosas/sacarosa, especialmente a elevado CO2, sugiriendo que el proceso de movilización

Discusión

79

de carbono asociado con la senescencia, ocurre de forma más temprana y más marcada en

plantas cultivadas a elevada concentración de CO2. La razón de este incremento en azúcares

solubles puede ser debido a que bajo elevado de CO2 se sintetiza mayor cantidad de almidón

en hojas maduras fotosintéticamente activas. También, este incremento en azúcares solubles

puede ser el resultado de que el proceso de senescencia promueve un descenso en la

integridad estructural y funcional de membranas celulares, acelerando de este modo el

catabolismo de lípidos de membrana produciéndose azúcares por gluconeogénesis

(Buchanan-Wollaston et al. 2003; Lim et al. 2007). Los azúcares regulan muchos procesos

metabólicos y del desarrollo y en muchos de ellos está involucrada la enzima hexoquinasa

como sensor de azúcares. La hexoquinasa puede ser responsable de la regulación del proceso

de senescencia dependiente de azúcares, de forma que su sobreexpresión inhibe el

crecimiento de la planta, disminuye la actividad fotosintética e induce rápidamente la

senescencia (Wingler et al. 2004). Cuando las plantas de pepino se expusieron a elevado CO2

se observó en las hojas un aumento en almidón y azúcares solubles y un descenso en el

contenido de nitrato (Larios et al. 2001; Agüera et al. 2006). Hay evidencias que sugieren

que la vía de señalización de los azúcares juega un papel importante en la regulación de la

senescencia, sin embargo, existen otras vías de señalización inducidas por diferentes tipos de

estrés tanto bióticos como abióticos (Wingler y Roitsch 2008; Schippers et al. 2015).

Por otro lado, se ha sugerido que los cambios en el metabolismo de la hoja causados

por el elevado CO2 están relacionados con sus niveles de nitrógeno (Kim et al. 2006; Leakey

et al. 2009; Sanz-Sáez et al. 2010). Nuestros resultados muestran que la razón C/N

incrementa con la edad en la hoja, especialmente a elevado CO2, resultados similares fueron

previamente observados en plantas de soja (Rogers et al. 2004; Ainsworth et al. 2006). El

crecimiento en atmósfera a elevado CO2, normalmente produce una acumulación de azúcares

solubles y almidón, reduciendo los niveles de nitrógeno (Ainsworth y Long 2005).

Generalmente las plantas creciendo a elevado CO2 están más limitadas en nitrógeno que en

carbono. El desequilibrio en la razón C/N puede acelerar el proceso de senescencia, con el fin

de incrementar la disponibilidad de nitrógeno por movilización de éste desde las hojas viejas

hasta los órganos en crecimiento (Wiedemuth et al. 2005; Wingler et al. 2006; Zhu et al.

2009).

En el capítulo II se estudió cómo la elevada concentración de CO2 atmosférico (800

µL L−1) afecta a la actividad y expresión de algunas enzimas que tienen un papel clave en el

metabolismo del nitrógeno (NR, GS y GDH) durante el desarrollo de la hoja. Plantas

Discusión

80

cultivadas a elevada concentración de CO2, mostraron durante su desarrollo, una menor

actividad NR y GS que aquellas cultivadas en CO2 ambiental. Stitt y Krapp (1999) indicaron

que diferentes especies vegetales cultivadas a elevado CO2 presentaron un mayor crecimiento

e incremento en la velocidad de asimilación de nitrógeno. Sin embargo, en plantas de trigo y

Arabidopsis se comprobó que el elevado CO2 atmosférico disminuyó la asimilación de

nitrógeno (Bloom et al. 2010), lo cual podría ser la causa del menor contenido en proteínas

observado en estas plantas (Kimball et al. 2001; Högy et al. 2009). El elevado CO2

atmosférico disminuye el proceso de fotorrespiración y la disponibilidad de NADH en el

citosol (Bloom et al. 2010). También se ha observado que el proceso de fotorrespiración,

estimula el transporte de malato desde el cloroplasto al citosol a través del translocador de

ácidos dicarboxílicos (Backhausen et al. 1998), aumentando así la disponibilidad de NADH

citosolico (Igamberdiev et al. 2001), y favoreciendo el proceso de reducción de nitrato

(Quesada et al. 2000). Por otro lado, se ha comprobado que seis transportadores de la familia

Nar1 están implicados en el transporte de nitrito desde el citosol al cloroplasto en

Chlamydomonas, algunos de ellos transportan tanto nitrito como bicarbonato (HCO3-)

(Mariscal et al. 2006). Un sistema análogo al descrito en Chlamydomonas opera también en

plantas superiores (Bloom et al. 2010) ya que se ha observado en cloroplastos aislados de

trigo y de guisante que la presencia de HCO3- inhibe el trasporte de nitrito al interior del

cloroplasto. La menor entrada de nitrito en el cloroplasto bajo condiciones de elevado CO2

podría ser la causa de la reducción de la actividad GS observada en plantas de girasol

creciendo a elevada concentración de CO2.

También se estudió la expresión relativa de las isoformas GS citosólica (GS1) y

cloroplástica (GS2) durante el desarrollo de hojas de girasol observándose que el elevado

CO2 atmosférico incrementó la expresión relativa de la isoforma GS1 y disminuyó los niveles

de transcritos de la isoforma GS2. Durante el proceso de senescencia, las células sufren

cambios metabólicos muy drásticos y una degeneración secuencial de las estructuras

celulares comenzando por la degradación de los cloroplastos. Estos orgánulos juegan un

doble papel durante el proceso de senescencia, ya que actúan como fuente de nitrógeno y

como reguladores de su propia degradación (Zapata et al. 2005, Girondé et al. 2015). El

incremento de CO2 atmosférico podría aumentar los procesos que conducen a la aceleración

de la senescencia en hojas de girasol, incluyendo la degradación de los cloroplastos donde se

localiza la GS2 (McNally y Hirel 1983). Diversos estudios han mostrado que la isoforma

GS1 está implicada en la movilización de nitrógeno durante el proceso de senescencia de la

Discusión

81

hoja (Swarbreck et al. 2011). En plantas C3 la mayor parte del amonio asimilado bajo

condiciones de CO2 ambiental procede del proceso de fotorrespiración, y es asimilado por la

isoforma GS2 (Sttit y Krapp 1999). La elevada concentración de CO2 disminuye la

fotorrespiración (Foyer et al. 2009), este hecho explicaría los menores niveles de transcritos

de GS2 encontrados en hojas de girasol creciendo a elevado CO2. Por otro lado, la actividad GDH desaminante aumentó en hojas senescentes de girasol

en ambos tratamientos; sin embargo, los niveles de actividad fueron significativamente más

altos en las plantas tratadas con elevada concentración de CO2. Lea y Miflin (2003)

mostraron que la GDH actúa principalmente catalizando la reacción de desaminación y por

tanto produciendo amonio en la mitochondria. Por lo que es lógico el aumento de los niveles

de GDH desaminante con el incremento de CO2 en la atmósfera y con la edad de la hoja

observado en plantas de girasol. En Arabidopsis la edad de la planta induce la expresión del

gen gdh2 y la actividad GDH, sugiriendo que la GDH participa en la degradación y el

reciclaje de nitrógeno en esta planta (Díaz et al. 2008).

Los cambios observados en las enzimas del metabolismo del nitrógeno junto con el

incremento en la razón C/N, durante el desarrollo de hojas primarias de girasol, indican que

el elevado CO2 atmosférico determina una limitación gradual del nitrógeno en las hojas de

girasol, ya que la acumulación de carbohidratos en las hojas ocurre de forma más rápida que

el proceso de absorción de nitrógeno (Reich et al. 2006). La disponibilidad limitada de

nitrógeno conduce a una senescencia temprana e incrementa el estado oxidativo de las células

de hojas de girasol (Agüera et al. 2010).

En el capítulo III se estudió la influencia de diferentes intensidades de luz sobre el

desarrollo de hojas primarias de girasol, en plantas cultivadas durante 50 días bajo dos

tratamientos de irradiancia: elevada irradiancia (350 µmol de fotones m–2 s–1, HI) y baja

irradiancia (125 µmol de fotones m–2 s–1, LI). Nuestros resultados muestran que al inicio del

desarrollo de la hoja, la HI incrementó el área foliar, la SLM y el contenido en proteína

soluble. Esto podría ser el resultado del incremento de la capacidad fotosintética observado

durante las primeras etapas de desarrollo de la hoja primaria, en plantas cultivadas a HI. En

estadios más tardíos del desarrollo de la hoja, la velocidad de fotosíntesis disminuye de forma

más rápida en plantas a HI que en plantas a LI. También se observó un descenso en el

contenido de proteína soluble durante el desarrollo de la hoja que podría ser causado por la

degradación de las proteínas del cloroplasto como observaron Martínez et al. (2008). Por otro

lado, los cambios en el contenido de proteínas pueden reflejar alteraciones en la distribución

Discusión

82

de compuestos de carbono y nitrógeno como consecuencia de una mayor eficiencia en la

movilización de nitrógeno durante la senescencia (Díaz et al. 2008).

El desarrollo de la hoja tuvo un efecto negativo sobre el contenido en pigmentos

fotosintéticos de plantas de girasol en ambos tratamientos. El contenido en clorofila a y b fue

menor en plantas a HI que en plantas a LI a lo largo del desarrollo de la hoja. Las plantas

pueden evitar el exceso de absorción de luz reduciendo la síntesis de clorofilas, variando la

orientación de las hojas o reflejando la luz incidente (Adams et al. 2004; Baig et al. 2005;

Demmig-Adams y Adams 2006). La pérdida de clorofila es típica de hojas senescentes y

podría ser usada como marcador del proceso de senescencia (Ougham et al. 2008). Astolfi et

al. (2001) también observaron, a elevada irradiancia, un descenso en el contenido de clorofila

lo que induce senescencia prematura en las hojas. La mayor velocidad de fotosíntesis

observada en plantas jóvenes de girasol podría deberse a un incremento en el contenido en

rubisco (Ariz et al. 2010) y/o también a una mayor eficiencia en la penetración de la

radiación incidente (Radochová y Tichá 2008). El contenido en carotenoides de hojas

primarias de girasol fue más elevado en plantas HI, lo que sugiere que estas plantas sintetizan

mayor cantidad de carotenoides como una estrategia adaptativa para proteger su maquinaria

fotosintética frente a elevadas intensidades (Behera y Choudhury 2001, 2003; Lichtenthaler

2007).

La concentración de azúcares solubles incrementó durante el desarrollo de la hoja

primaria de girasol hasta los 42 días en ambos tratamientos, disminuyendo ligeramente el

contenido en glucosa y sacarosa en hojas más senescentes (50 días). Sin embargo, el

contenido en almidón disminuyó con el desarrollo de la hoja y especialmente en plantas a HI.

Nuestros resultados muestran acumulación significativa de glucosa al inicio de la

senescencia. Ono et al. (2001) han mostrado que hojas de girasol y judía, sometidas a baja

irradiancia reducen su contenido en azúcares y retrasan el proceso de senescencia, lo cual

sugiere que la acumulación de carbohidratos induce la senescencia de la hoja.

Se ha estudiado el metabolismo del nitrógeno a lo largo del desarrollo de las hojas

primarias de girasol. Se encontró que la actividad NR, tanto en presencia como en ausencia

de Mg2+, así como el estado de activación de la enzima NR, disminuyeron durante el

desarrollo de la hoja en ambos tratamientos. Sin embargo, en plantas a HI el estado de

activación de la enzima NR incrementó durante las primeras etapas de desarrollo de la hoja y

disminuyó drásticamente durante la senescencia. De la Haba et al. (2001), observaron en

plantas de pepino, un aumento de actividad y del estado de activación de la NR con la

Discusión

83

elevada irradiancia y un descenso en oscuridad, atribuyendo este efecto a un mecanismo de

regulación por fosforilación/ defosforilación de la NR en respuesta a luz/oscuridad.

Nuestros resultados muestran que la actividad GS disminuyó a lo largo del desarrollo

en ambos tratamientos, observándose mayores niveles de GS a HI. El efecto de la luz sobre la

expresión de los genes que codifican la isoforma GS2 ha sido estudiada por Oliveira y

Coruzzi (1999). Ellos observaron que la isoforma cloroplástica se induce por luz o por

metabolitos del carbono tales como la sacarosa; también se conoce que la actividad GS

disminuye durante la senescencia de la hoja (Masclaux et al. 2000; Cabello et al. 2006). La

pérdida de actividad GS a lo largo del desarrollo de la hoja es debida principalmente a una

disminución progresiva de la actividad y de la expresión de la isoforma GS2 ya que la

isoforma GS1 incrementa durante el desarrollo de la hoja (Cabello et al. 2006).

Las plantas de girasol cultivadas a HI presentaron mayor estrés oxidativo al final del

desarrollo de la hoja, como se reveló por el incremento en el contenido de H2O2, así como por

el descenso de actividad de enzimas antioxidantes (catalasa y APX). La elevada intensidad

luminosa causa una fotoinhibición reversible de la fotosíntesis en cloroplastos de guisante y

un incremento de ROS (Hernández et al. 2006). Nuestros resultados sugieren que a HI se

acelera el proceso de senescencia en hojas primarias de plantas de girasol, y este proceso se

lleva a cabo con el fin de asegurar la funcionalidad de las hojas jóvenes.

En el capítulo IV se estudió el efecto del incremento de la temperatura desde un

régimen de día/noche de 23/19 ºC (control) a 33/29 ºC (elevada temperatura), sobre diferentes

procesos bioquímicos y fisiológicos a lo largo del desarrollo de la hoja primaria de girasol. La

elevada temperatura es una causa importante de estrés medioambiental que limita la

producción agrícola en el mundo (Hasanuzzaman et al. 2013). Nuestros resultados muestran

que hojas primarias de girasol sometidas a elevada temperatura presentan un menor

crecimiento como se refleja en la menor área foliar, SLM y en el contenido de proteína

soluble con respecto al control. La elevada temperatura afecta al crecimiento de la planta ya

que es una de las situaciones de estrés que actúa estimulando la degradación de proteínas, lo

que conlleva a la senescencia y muerte de los tejidos vegetales (Ferguson et al. 1990;

Scheurwater et al. 2000; Martínez et al. 2008).

La fotosíntesis es uno de los procesos fisiológicos más sensible a la elevada

temperatura (Crafts-Brandner y Salvucci 2002). Nuestros resultados mostraron que la elevada

temperatura disminuyó la fotosíntesis neta en hojas primarias de girasol, el efecto adverso de

la elevada temperatura sobre la fotosíntesis puede ser debido al menor contenido en

Discusión

84

pigmentos fotosintéticos y al cierre parcial de los estomas observado en las hojas. Greer y

Weston (2010) obsevaron en hojas de Vitis vinifera, que la velocidad de fotosíntesis

disminuyó hasta un 60% al incrementar la temperatura de 25 a 45 ºC, esta reducción en la

fotosíntesis se atribuyó al cierre parcial de estomas. También se ha descrito que el

metabolismo del carbono (en el estroma del cloroplasto) y las reacciones fotoquímicas (en las

membranas tilacoidales) son los procesos afectados en primer lugar por la elevada

temperatura (Wang et al. 2009). La elevada temperatura causa la reducción del estado de

activación de la rubisco por inactivación de la rubisco activasa y disminución del proceso de

carbamilación de la rubisco (Crafts-Brandner y Law 2000; Han et al. 2009). Las plantas de

girasol cultivadas a elevada temperatura mostraron bajos niveles de clorofilas a y b, la

pérdida de clorofila es característica del proceso de senescencia, y puede ser utilizada como

marcador de este proceso (Ougham et al. 2008). En plantas de sorgo sometidas a elevada

temperatura se observó que la pérdida de clorofila ocurre también como resultado de la

peroxidación de lípidos de las membranas tilacoidales (Mohammed y Tarpley 2010). El

contenido en carotenoides en hojas primarias de girasol fue menor en plantas sometidas a

elevada temperatura. Este menor contenido en carotenoides podría afectar negativamente a la

planta ya que estos pigmentos tienen una función antioxidante importante impidiendo la

peroxidación lipídica en la planta (Havaux 1998; Havaux et al. 2007). También se ha puesto

de manifiesto que la elevada temperatura puede tener un efecto negativo sobre las membranas

de los tilacoides ya que disminuye la proporción de ácidos grasos saturados/insaturados en

los lípidos de membrana, incrementando su fluidez (Schrader et al. 2004).

El incremento en los niveles de azúcares (glucosa, fructosa y sacarosa) observados

durante el desarrollo de la hoja, especialmente a elevada temperatura, sugieren que la elevada

temperatura acelera el proceso de senescencia en hojas primarias de plantas de girasol.

También los contenidos en azúcares solubles en hojas de Lonicera japonica y de pepino

aumentaron cuando las plantas se sometieron a estrés por calor (Li et al. 2011; Zhang et al.

2012). Nuestros resultados indican que la acumulación de azúcares en las hojas de girasol

puede ser debido a la hidrólisis de almidón más que al proceso de fijación de CO2 ya que se

observó un descenso en la velocidad de fotosíntesis durante la senescencia y sobre todo, en

plantas sometidas a elevada temperatura. Hakata et al. (2012) observaron una inducción de la

expresión de la enzima α-amilasa en plantas de arroz sometidas a altas temperaturas. El

incremento en azúcares solubles (glucosa principalmente) durante el proceso de senescencia

Discusión

85

también puede deberse al catabolismo lipídico de las membranas celulares a través del cual se

forman azúcares por gluconeogénesis (Buchanan-Wollaston et al. 2003; Lim et al. 2007).

Durante el desarrollo de la hoja, el incremento de la temperatura produjo alteraciones

en algunas enzimas claves del metabolismo del nitrógeno (NR, GS y GDH). Las plantas

cultivadas a elevada temperatura mostraron niveles más bajos de actividad NR y GS que las

plantas control a lo largo del desarrollo de la hoja. La actividad NR y GS están directamente

relacionadas con la fotosíntesis, debido a que estas enzimas requieren poder reductor y ATP

respectivamente, y además la GS relaciona el metabolismo del carbono y del nitrógeno a

través de la incorporación de amonio a esqueletos carbonados (Lam et al. 1996). Debido a

que la asimilación del nitrógeno y del carbono están acopladas en el metabolismo de las

plantas, la disminución de la velocidad de fotosíntesis que ocurre a elevada temperatura

afecta negativamente al metabolismo del nitrógeno (Wollenweber et al. 2003; Xu et al.

2006). Las hojas senescentes de girasol mostraron una mayor actividad GDH desaminante en

plantas cultivadas a elevada temperaturas. La GDH tiene especial importancia en el

catabolismo de los aminoácidos, especialmente en la liberación de amonio para su posterior

incorporación en aminoácidos durante el proceso de senescencia (Masclaux-Daubresse et al.

2005). La elevada temperatura y la edad de la hoja induce la movilización de nitrógeno, que

es característica del proceso de senescencia (Díaz et al. 2008).

El estrés por elevadas temperaturas, al igual que ocurre con otros tipos de estrés

abióticos, puede producir un desequilibrio enzimático causante de la acumulación de ROS y

responsables del estrés oxidativo (Asada 2006). Las plantas de girasol cultivadas a elevada

temperatura mostraron estrés oxidativo, como se refleja en el incremento del contenido de

H2O2 y en el descenso de las enzimas antioxidantes catalasa y APX. En hojas de caña de

azúcar, tolerantes al calor, se observó un incremento en la expresión de las enzimas catalasa y

APX al aumentar la temperatura, siendo esto un mecanismo de protección frente a las ROS

que se producen en estas plantas a elevada temperatura (Procházková y Wilhelmová 2007;

Pompelli et al. 2010; Srivastava et al. 2012). Nuestros resultados sugieren que la elevada

temperatura acelera el proceso de senescencia en hojas primarias de plantas de girasol, debido

en parte a la oxidación celular causada por la acumulación de H2O2, y a la disminución de la

actividad de enzimas antioxidantes.

9. CONCLUSIONES

Conclusiones

89

9.1. Capítulo I

Growth under elevated atmospheric CO2 concentration accelerates leaf senescence in

sunflower (Helianthus annuus L.) plants.

1. Hojas jóvenes de plantas de girasol cultivadas a elevado CO2, mostraron una mayor

velocidad de crecimiento como se refleja por la elevada SLM referida a peso seco.

2. El contenido en pigmentos fotosintéticos disminuyó con el desarrollo de la hoja,

especialmente en plantas que crecieron en condiciones de alto CO2 lo que indica que

el elevado CO2 acelera la degradación de clorofila y también probablemente la

senescencia de la hoja.

3. El elevado CO2 provocó un incremento en la velocidad de fotosíntesis, contenido en

azúcares solubles y almidón y en la tasas C/N a lo largo del desarrollo de la hoja.

Probablemente un desequilibrio en la relación C/N sería uno de los factores que

contribuyen a acelerar la senescencia de la hoja de plantas de girasol.

4. El elevado CO2 incrementa el estado oxidativo de la célula en plantas de girasol ya

que se observó un incremento en el contenido de H2O2 y una disminución en la

actividad de enzimas antioxidantes, lo que podría conducir a una senescencia

temprana en hojas de plantas de girasol.

9.2. Capítulo II

Elevated CO2 concentrations alter nitrogen metabolism and accelerate senescence in


5. El elevado CO2 disminuyó significativamente la actividad de enzimas del

metabolismo del nitrógeno NR y GS y los niveles de transcritos de la isoforma GS2.

Por otro lado, incrementó la actividad GDH desaminante así como los niveles de

transcritos de la isoforma G1 durante la ontogenia de hojas primarias de plantas de

girasol.

6. El elevado CO2 condujo a una senescencia temprana en hojas primarias de girasol

debido a una disminución en la asimilación de nitrógeno como consecuencia de los

efectos sobre enzimas claves del metabolismo del nitrógeno a nivel transcripcional

(GS1 y GS2) y post-transcripcional (NR, GS y GDH).

Conclusiones

90

9.3. Capítulo III

Study of the senescence process in primary leaves of sunflower (Helianthus annuus L.) plants

under two different light intensities

7. El contenido en pigmentos fotosintéticos disminuyó con el desarrollo de la hoja,

especialmente en plantas que crecieron a elevada irradiancia, lo que indica que la

elevada irradiancia acelera la degradación de clorofila y también probablemente la

senescencia de la hoja.

8. A elevada irradiancia el contenido en carotenoides fue mayor durante el desarrollo de

la hoja como estrategia adaptativa de las plantas para la protección de la maquinaria

fotosintética.

9. La acumulación de glucosa observada a elevada irradiancia en hojas maduras de

girasol puede actuar como señal de inducción en el proceso de senescencia.

10. La elevada irradiancia incrementó significativamente el contenido de H2O2 en hojas

de plantas de girasol y produjo una menor protección oxidativa lo que es una de las

causas de la senescencia temprana de la hoja.

9.4. Capítulo IV

High temperature promotes an early senescence in primary leaves of sunflower (Helianthus

annuus L.) plants.

11. En hojas primarias de girasol la elevada temperatura induce el proceso de senescencia

ya que disminuye el crecimiento, altera el metabolismo del carbono y del nitrógeno y

disminuye el estado oxidativo de la planta.

10. BIBLIOGRAFÍA

Bibliografía

93

Adams WW III, Zarter CR, Ebbert V, Demmig-Adams B. (2004) Photoprotective strategies of

overwintering evergreens. Bioscience 54: 41-49.

Adams WW III, Zarter CR, Mueh KE, Demmig-Adams B. (2006) Energy dissipation and

photoinhibition: a continuum of photoprotection. In: Demming-Adams B, Adams WIII,

Mattoo AK, eds. Photoprotection, photoinhibition, gene regulation, and environment.

Advances in photoshynthesis and respitation. Drodrecht, Springer, pp. 49-64.

Agüera E, Ruano D, Cabello P, de la Haba P. (2006) Impact of atmospheric CO2 on growth,

photosynthesis and nitrogen metabolism in cucumber (Cucumis sativus L.) plants. J Plant

Physiol 163: 809-817.

Agüera E, Cabello P, De La Haba P. (2010) Induction of leaf senescence by low nitrogen

nutrition in sunflower (Helianthus annuus) plants. Physiol Plant 138: 256-267.

Ainsworth EA, Long SP. (2005) What have we learned from 15 years of free-‐‑air CO2 enrichment

(FACE)? A meta-‐‑analytic review of the responses of photosynthesis, canopy properties

and plant production to rising CO2. New Phytol 165: 351-372.

Ainsworth EA, Rogers A, Vodkin LO, Walter A, Schurr U. (2006) The effects of elevated CO2

concentration on soybean gene expression. An analysis of growing and mature leaves.

Plant Physiol 142: 135-147.

Ainsworth EA, Rogers A. (2007) The response of photosynthesis and stomatal conductance to

rising [CO2]: mechanisms and environmental interactions. Plant Cell Environ 30: 258-

270.

Alscher RG, Donahue JL, Cramer CL. (1997) Reactive oxygen species and antioxidants:

relationships in green cells. Physiol Plant 100: 224-233.

Apel K, Hirt H. (2004) Reactive oxygen species: metabolism, oxidative stress, and signal

transduction. Annu Rev Plant Biol 55: 373-399.

Ariz I, Esteban R, García-Plazaola JI, Becerril JM, Aparicio-Tejo PM, Moran JF. (2010) High

irradiance induces photoprotective mechanisms and a positive effect on NH4 stress in

Pisum sativum L. J Plant Physiol 167: 1038-1045.

Aro E, Virgin I, Andersson B. (1993) Photoinhibition of photosystem II. Inactivation, protein

damage and turnover. Biochim Biophys Acta 1143: 113-134.

Bibliografía

94

Arzamendi G, Campo I, Arguiñarena E, Sánchez M, Montes M, Gandía LM. (2008) Synthesis of

biodiesel from sunflower oil with silica-‐‑supported NaOH catalysts. J Chem Technol

Biotechnol 83: 862-870.

Asada K. (1999) The water-water cycle in chloroplasts: scavenging of active oxygens and

dissipation of excess photons. Annu Rev Plant Physiol Plant Biol 50: 601-639.

Asada K. (2006) Production and scavenging of reactive oxygen species in chloroplasts and their

functions. Plant Physiol 141: 391-396.

Astolfi S, De Biasi M, Passera C. (2001) Effects of irradiance-sulphur interactions on enzymes of

carbon, nitrogen, and sulphur metabolism in maize plants. Photosynthetica 39: 177-181.

Backhausen JE, Emmerlich A, Holtgrefe S, Horton P, Nast G, Rogers JJ, Müller-Röber B,

Scheibe R. (1998) Transgenic potato plants with altered expression levels of chloroplast

NADP-malate dehydrogenase: interactions between photosynthetic electron transport and

malate metabolism in leaves and in isolated intact chloroplasts. Planta 207: 105-114.

Baig M, Anand A, Mandal P, Bhatt R. (2005) Irradiance influences contents of photosynthetic

pigments and proteins in tropical grasses and legumes. Photosynthetica 43: 47-53.

Bazzaz FA, Fajer ED. (1992) Plant life in a CO2-rich world. Sci Am 266: 68-74.

Behera RK, Choudhury NK. (2001) Photosynthetic characteristics of chloroplasts of primary

wheat leaves grown under different irradiance. Photosynthetica 39: 11-15.

Behera RK, Choudhury NK. (2003) High irradiance-induced changes in carotenoid composition

and increase in non-photochemical quenching of Chl a fluorescence in primary wheat

leaves. J Plant Physiol 160: 1141-1146.

Bernard SM, Habash DZ. (2009) The importance of cytosolic glutamine synthetase in nitrogen

assimilation and recycling. New Phytol 182: 608-620.

Bloom AJ, Burger M, Rubio Asensio JS, Cousins AB. (2010) Carbon dioxide enrichment inhibits

nitrate assimilation in wheat and Arabidopsis. Science 328: 899-903.

Brugière N, Dubois F, Limami AM, Lelandais M, Roux Y, Sangwan RS, Hirel B. (1999)

Glutamine synthetase in the phloem plays a major role in controlling proline production.

Plant Cell 11: 1995-2012.

Brutnell TP, Langdale JA. (1998) Signals in leaf development. In: Callow JA, ed. Advances in

Botanical Research. Birmingham, Academic Press, pp. 162-196.

Bibliografía

95

Buchanan BB, Gruissem W, Jones RL. (2000) Biochemistry and Molecular Biology of plants.

Rockville, American Society of Plant Physiologists Vol. 40.

Buchanan-Wollaston V, Wellesbourne HRI. (2003) Senescence, leaves. In: Thomas B, Murphy

DJ, Murray BG, eds. Encyclopedia of applied plant sciences, Amsterdam, Elsevier

Academic Press, pp. 808-816.

Cabello P, Agüera E, De La Haba P. (2006) Metabolic changes during natural ageing in

sunflower (Helianthus annuus) leaves: expression and activity of glutamine synthetase

isoforms are regulated differently during senescence. Physiol Plant 128: 175-185.

Cantamutto M, Poverene M. (2007) Genetically modified sunflower release: opportunities and

risks. Field Crops Res 101: 133-144.

Christensen JH, Christensen OB. (2007) A summary of the PRUDENCE model projections of

changes in European climate by the end of this century. Clim Change 81: 7-30.

Crafts-Brandner S, Law R. (2000) Effect of heat stress on the inhibition and recovery of the

ribulose-1, 5-bisphosphate carboxylase/oxygenase activation state. Planta 212: 67-74.

Crafts-Brandner SJ, Salvucci ME. (2002) Sensitivity of photosynthesis in a C4 plant, maize, to

heat stress. Plant Physiol 129: 1773-1780.

Curtis P. (1996) A meta-analysis of leaf gas exchange and nitrogen in trees grown under elevated

carbon dioxide. Plant Cell Environ 19: 127-137.

Dat JF, Lopez-Delgado H, Foyer CH, Scott IM. (1998) Parallel changes in H2O2 and catalase

during thermotolerance induced by salicylic acid or heat acclimation in mustard

seedlings. Plant Physiol 116: 1351-1357.

Dat JF, Vandenabeele S, Vranová E, Van Montagu M, Inzé D, Van Breusegem F. (2000) Dual

action of the active oxygen species during plant stress responses. Cell Mol Life Sci 57:

779-795.

De la Haba P, Agüera E, Benı́tez L, Maldonado JM. (2001) Modulation of nitrate reductase

activity in cucumber (Cucumis sativus) roots. Plant Sci 161: 231-237.

Demirevska-Kepova K, Holzer R, Simova-Stoilova L, Feller U. (2005) Heat stress effects on

ribulose-1, 5-bisphosphate carboxylase/oxygenase, rubisco binding protein and rubisco

activase in wheat leaves. Biol Plant 49: 521-525.

Bibliografía

96

Demmig-‐‑Adams B, Adams WW. (2006) Photoprotection in an ecological context: the

remarkable complexity of thermal energy dissipation. New Phytol 172: 11-21.

Díaz C, Lemaitre T, Christ A, Azzopardi M, Kato Y, Sato F, Morot-Gaudry JF, Le Dily F,

Masclaux-Daubresse C. (2008) Nitrogen recycling and remobilization are differentially

controlled by leaf senescence and development stage in Arabidopsis under low nitrogen

nutrition. Plant Physiol 147: 1437-1449.

Drake BG, Gonzàlez-Meler MA, Long SP. (1997) More efficient plants: a consequence of rising

atmospheric CO2? Annu Rev Plant Physiol Plant Mol Biol 48: 609-639.

Druart N, Rodríguez-Buey M, Barron-Gafford G, Sjödin A, Bhalerao R, Hurry V. (2006)

Molecular targets of elevated [CO2] in leaves and stems of Populus deltoides:

implications for future tree growth and carbon sequestration. Func Plant Biol 33: 121-

131.

Erice G, Aranjuelo I, Irigoyen JJ, Sánchez-‐‑Díaz M. (2007) Effect of elevated CO2, temperature

and limited water supply on antioxidant status during regrowth of nodulated alfalfa.

Physiol Plant 130: 33-45.

Feller U, Crafts-Brandner SJ, Salvucci ME. (1998) Moderately high temperatures inhibit

ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco) activase-mediated activation

of rubisco. Plant Physiol 116: 539-546.

Ferguson DL, Guikema JA, Paulsen GM. (1990) Ubiquitin pool modulation and protein

degradation in wheat roots during high temperature stress. Plant Physiol 92: 740-746.

Ferris R, Sabatti M, Miglietta F, Mills R, Taylor G. (2001) Leaf area is stimulated in Populus by

free air CO2 enrichment (POPFACE), through increased cell expansion and production.

Plant Cell Environ 24: 305-315.

Forde BG, Lea PJ. (2007) Glutamate in plants: metabolism, regulation, and signalling. J Exp Bot

58: 2339-2358.

Foyer CH, Harbinson J, Mullineaux P. (1994) Oxygen metabolism and the regulation of

photosynthetic electron transport. In: Foyer CH, Mullineaux PM, eds. Causes of

photooxidative stress and amelioration of defense systems in plants. Boca Raton, CRC

Press pp. 1-42.

Bibliografía

97

Foyer CH, Bloom AJ, Queval G, Noctor G. (2009) Photorespiratory metabolism: genes, mutants,

energetics, and redox signaling. Ann Rev Plant Biol 60: 455-484.

Gan S, Amasino RM. (1997) Making sense of senescence (Molecular Genetic regulation and

manipulation of leaf senescence). Plant Physiol 113: 313-319.

Geissler N, Hussin S, Koyro HW. (2009) Elevated atmospheric CO2 concentration ameliorates

effects of NaCl salinity on photosynthesis and leaf structure of Aster tripolium L. J Exp

Bot 60: 137-151.

Gepstein S. (1998) Photosynthesis. In: L Nooden, AC Leopold, ed. Senescence and aging in

plants. San Diego, Academic Press, pp 85-109.

Gillespie KM, Rogers A, Ainsworth EA. (2011) Growth at elevated ozone or elevated carbon

dioxide concentration alters antioxidant capacity and response to acute oxidative stress in

soybean (Glycine max). J Exp Bot 62: 2667-2678.

Girondé A, Etienne P, Trouverie J, Bouchereau A, Le Cahérec F, Leport L, Orsel M, Niogret M,

Nesi N, Carole D. (2015) The contrasting N management of two oilseed rape genotypes

reveals the mechanisms of proteolysis associated with leaf N remobilization and the

respective contributions of leaves and stems to N storage and remobilization during seed

filling. BMC Plant Biol 15: 59.

Greer DH, Weedon MM. (2012) Modelling photosynthetic responses to temperature of grapevine

(Vitis vinifera cv. Semillon) leaves on vines grown in a hot climate. Plant, Cell Environ

35: 1050-1064.

Greer DH, Weston C. (2010) Heat stress affects flowering, berry growth, sugar accumulation and

photosynthesis of Vitis vinifera cv. Semillon grapevines grown in a controlled

environment. Func Plant Biol 37: 206-214.

Gruissem W, Lee C, Oliver M, Pogson B. (2012) The global plant council: Increasing the impact

of plant research to meet global challenges. J Plant Biol 55: 343-345.

Gupta P, Duplessis S, White H, Karnosky D, Martin F, Podila G. (2005) Gene expression

patterns of trembling aspen trees following long-‐‑term exposure to interacting elevated

CO2 and tropospheric O3. New Phytol 167: 129-142.

Bibliografía

98

Hakata M, Kuroda M, Miyashita T, Yamaguchi T, Kojima M, Sakakibara H, Mitsui T,

Yamakawa H. (2012) Suppression of α -‐‑amylase genes improves quality of rice grain

ripened under high temperature. Plant Biotechnol J 10: 1110-1117.

Han F, Chen H, Li X, Yang M, Liu G, Shen S. (2009) A comparative proteomic analysis of rice

seedlings under various high-temperature stresses. Biochim Biophys Acta 4: 1625-1634.

Hasanuzzaman M, Nahar K, Alam MM, Roychowdhury R, Fujita M. (2013) Physiological,

biochemical, and molecular mechanisms of heat stress tolerance in plants. Int J Mol Sci

14: 9643-9684.

Havaux M. (1998) Carotenoids as membrane stabilizers in chloroplasts. Trends Plant Sci 3: 147-

151.

Havaux M, Dall'osto L, Bassi R. (2007) Zeaxanthin has enhanced antioxidant capacity with

respect to all other xanthophylls in Arabidopsis leaves and functions independent of

binding to PSII antennae. Plant Physiol 145: 1506-1520.

Hernández JA, Escobar C, Creissen G, Mullineaux P. (2006) Antioxidant enzyme induction in

pea plants under high irradiance. Biol Plant 50: 395-399.

Högy P, Wieser H, Köhler P, Schwadorf K, Breuer J, Franzaring J, Muntifering R, Fangmeier A.

(2009) Effects of elevated CO2 on grain yield and quality of wheat: results from a 3-‐‑year

free-‐‑air CO2 enrichment experiment. Plant Biol 11: 60-69.

Hovenden MJ, Schimanski LJ. (2000) Genotypic differences in growth and stomatal morphology

of southern beech, Nothofagus cunninghamii, exposed to depleted CO2 concentrations.

Funct Plant Biol 27: 281-287.

Igamberdiev AU, Bykova NV, Lea PJ, Gardeström P. (2001) The role of photorespiration in

redox and energy balance of photosynthetic plant cells: a study with a barley mutant

deficient in glycine decarboxylase. Physiol Plant 111: 427-438.

IPCC (2007) Climate change 2007: The physical science basis. In: Solomon SD, Qin M,

Manning Z, Chen M, Marquis M, Averyt KB, Tignor MM, Miller HL, eds. Contribution

of working group I to the fourth assessment. Report of the intergovernmental panel on

climate change. Cambridge, Cambridge University Press.

IPCC (2014) Climate change 2014: Impacts, adaptations and vulnerability. In: Field CB, Barros

VR, Dokken DJ, Mach KJ et al. eds. Contribution of working group II to the fifth

Bibliografía

99

assessment. Report of the intergovernmental panel on climate change, Ginebra,

Cambridge University Press.

Irigoyen JJ, Emerich D, Sánchez-‐‑Diaz M. (1992) Alfalfa leaf senescence induced by drought

stress: photosynthesis, hydrogen peroxide metabolism, lipid peroxidation and ethylene

evolution. Physiol Plant 84: 67-72.

Jiang D, Lu Q, Weng X, Zheng B, Xi H. (1999) Regulation of rubisco carboxylation activity and

photosynthetic rate by rubisco activase during leaf senescence in rice. J Zhejiang Univ

(Agricult Life Sci) 26: 119-124.

Johnson SM, Doherty SJ, Croy RR. (2003) Biphasic superoxide generation in potato tubers. A

self-amplifying response to stress. Plant Physiol 131: 1440-1449.

Keeling CD. (1960) The concentration and isotopic abundances of carbon dioxide in the

atmosphere. Tellus 12: 200-203.

Kim J, Lee K, Shin K, Kang J, Lee H, Kim M, Jang P, Jang M. (2006) The effect of seawater

CO2 concentration on growth of a natural phytoplankton assemblage in a controlled

mesocosm experiment. Limnol Oceanogr 51: 1629-1636.

Kimball B, Morris C, Pinter P, Wall G, Hunsaker D, Adamsen F, LaMorte R, Leavitt S,

Thompson T, Matthias A. (2001) Elevated CO2, drought and soil nitrogen effects on

wheat grain quality. New Phytol 150: 295-303.

Kinsman E, Lewis C, Davies M, Young J, Francis D, Vilhar B, Ougham H. (1997) Elevated CO2

stimulates cells to divide in grass meristems: a differential effect in two natural

populations of Dactylis glomerata. Plant Cell Environ 20: 1309-1316.

Kontunen-Soppela S, Parviainen J, Ruhanen H, Brosche M, Keinänen M, Thakur RC,

Kolehmainen M, Kangasjärvi J, Oksanen E, Karnosky DF. (2010) Gene expression

responses of paper birch (Betula papyrifera) to elevated CO2 and O3 during leaf

maturation and senescence. Environ Pollut 158: 959-968.

Lam H, Coschigano K, Oliveira I, Melo-Oliveira R, Coruzzi G. (1996) The molecular-genetics of

nitrogen assimilation into amino acids in higher plants. Annu Rev Plant Physiol Plant

Mol Biol 47: 569-593.

Bibliografía

100

Larios B, Agüera E, de la Haba P, Pérez-Vicente R, Maldonado JM. (2001) A short-term

exposure of cucumber plants to rising atmospheric CO2 increases leaf carbohydrate

content and enhances nitrate reductase expression and activity. Planta 212: 305-312.

Laurière C, Daussant J. (1983) Identification of the ammonium-‐‑dependent isoenzyme of

glutamate dehydrogenase as the form induced by senescence or darkness stress in the first

leaf of wheat. Physiol Plant 58: 89-92.

Lea PJ, Miflin BJ. (2003) Glutamate synthase and the synthesis of glutamate in plants. Plant

Physiol Biochem 41: 555-564.

Leakey AD, Ainsworth EA, Bernacchi CJ, Rogers A, Long SP, Ort DR. (2009) Elevated CO2

effects on plant carbon, nitrogen, and water relations: six important lessons from FACE. J

Exp Bot 60: 2859-2876.

Lee R, Chen SG. (2002) Programmed cell death during rice leaf senescence is nonapoptotic. New

Phytol 155: 25-32.

Lehmann T, Ratajczak L. (2008) The pivotal role of glutamate dehydrogenase (GDH) in the

mobilization of N and C from storage material to asparagine in germinating seeds of

yellow lupine. J Plant Physiol 165: 149-158.

Li Q, Zheng Q, Shen W, Cram D, Fowler DB, Wei Y, Zou J. (2015) Understanding the

biochemical basis of temperature-induced lipid pathway adjustments in plants. Plant Cell

27: 86-103.

Li WD, Hu X, Liu JK, Jiang GM, Li O, Xing D. (2011) Chromosome doubling can increase heat

tolerance in Lonicera japonica as indicated by chlorophyll fluorescence imaging. Biol

Plant 55: 279-284.

Lichtenthaler HK. (2007) Biosynthesis, accumulation and emission of carotenoids, α-tocopherol,

plastoquinone, and isoprene in leaves under high photosynthetic irradiance. Photosynth

Res 92: 163-179.

Lim PO, Woo HR, Nam HG. (2003) Molecular genetics of leaf senescence in Arabidopsis.

Trends Plant Sci 8: 272-278.

Lim PO, Kim HJ, Gil Nam H. (2007) Leaf senescence. Annu Rev Plant Biol 58: 115-136.

Logan BA, Kornyeyev D, Hardison J, Holaday AS. (2006) The role of antioxidant enzymes in

photoprotection. Photosynth Res 88: 119-132.

Bibliografía

101

Long SP, Ainsworth EA, Rogers A, Ort DR. (2004) Rising atmospheric carbon dioxide: plants

FACE the future. Annu Rev Plant Biol 55: 591-628.

Long SP, Zhu XG, Naidu SL, Ort DR. (2006) Can improvement in photosynthesis increase crop

yields? Plant Cell Environ 29: 315-330.

Maldonado JM, Agüera E, Pérez R. (2000) Asimilación del nitrógeno y del azufre. In: Azcón-

Bieto J, Talón M, eds. Fundamentos de Fisiología Vegetal S.A. Madrid Mcgraw-hill /

Interamericana de España, pp. 235-246.

Mani D, Sharma B, Kumar C. (2007) Phytoaccumulation, interaction, toxicity and remediation of

cadmium from Helianthus annuus L. (sunflower). Bull Environ Contam Toxicol 79: 71-

79.

Mariscal V, Moulin P, Orsel M, Miller AJ, Fernández E, Galván A. (2006) Differential

regulation of the Chlamydomonas Nar1 gene family by carbon and nitrogen. Protist 157:

421-433.

Martinelli T, Whittaker A, Bochicchio A, Vazzana C, Suzuki A, Masclaux-Daubresse C. (2007)

Amino acid pattern and glutamate metabolism during dehydration stress in the

'resurrection' plant Sporobolus stapfianus: a comparison between desiccation-sensitive

and desiccation-tolerant leaves. J Exp Bot 58: 3037-3046.

Martínez DE, Costa ML, Guiamet JJ. (2008) Senescence-‐‑associated degradation of chloroplast

proteins inside and outside the organelle. Plant Biology 10: 15-22.

Masclaux C, Valadier MH, Brugière N, Morot-Gaudry JF, Hirel B. (2000) Characterization of

the sink/source transition in tobacco (Nicotiana tabacum L.) shoots in relation to nitrogen

management and leaf senescence. Planta 211: 510-518.

Masclaux-Daubresse C, Carrayol E, Valadier MH. (2005) The two nitrogen mobilisation-and

senescence-associated GS1 and GDH genes are controlled by C and N metabolites. Planta

221: 580-588.

McNally S, Hirel B. (1983) Glutamine synthetase isoforms in higher plants. Physiologie

Végétale 21: 761-774.

Melis A. (1999) Photosystem-II damage and repair cycle in chloroplasts: what modulates the rate

of photodamage in vivo? Trends Plant Sci 4: 130-135.

Bibliografía

102

Melo-Oliveira R, Oliveira IC, Coruzzi GM. (1996) Arabidopsis mutant analysis and gene

regulation define a nonredundant role for glutamate dehydrogenase in nitrogen

assimilation. Proc Natl Acad Sci 93: 4718-4723.

Miflin BJ, Habash DZ. (2002) The role of glutamine synthetase and glutamate dehydrogenase in

nitrogen assimilation and possibilities for improvement in the nitrogen utilization of

crops. J Exp Bot 53: 979-987.

Mishra RK, Singhal GS. (1992) Function of photosynthetic apparatus of intact wheat leaves

under high light and heat stress and its relationship with peroxidation of thylakoid lipids.

Plant Physiol 98: 1-6.

Mittler R. (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7: 405-410.

Mohammed AR, Tarpley L. (2010) Effects of high night temperature and spikelet position on

yield-related parameters of rice (Oryza sativa L.) plants. Eur J Agron 33: 117-123.

Morison JIL. (1998) Stomatal response to increased CO2 concentration. J Exp Bot 49: 443-452.

Murata N, Takahashi S, Nishiyama Y, Allakhverdiev SI. (2007) Photoinhibition of photosystem

II under environmental stress. Biochim Biophys Acta 1767: 414-421.

Nam HG. (1997) The molecular genetic analysis of leaf senescence. Curr Opin Biotechnol 8:

200-207.

Nishimura C, Ohashi Y, Sato S, Kato T, Tabata S, Ueguchi C. (2004) Histidine kinase homologs

that act as cytokinin receptors possess overlapping functions in the regulation of shoot

and root growth in Arabidopsis. Plant Cell 16: 1365-1377.

Noodén LD, Guiamét JJ, John I. (1997) Senescence mechanisms. Physiol Plant 101: 746-753.

Oliveira IC, Coruzzi GM. (1999) Carbon and amino acids reciprocally modulate the expression

of glutamine synthetase in Arabidopsis. Plant Physiol 121: 301-310.

Ono K, Nishi Y, Watanabe A, Terashima I. (2001) Possible mechanisms of adaptive leaf

senescence. Plant Biol 3: 234-243.

Ougham H, Hörtensteiner S, Armstead I, Donnison I, King I, Thomas H, Mur L. (2008) The

control of chlorophyll catabolism and the status of yellowing as a biomarker of leaf

senescence. Plant Biol 10: 4-14.

Pageau K, Reisdorf-Cren M, Morot-Gaudry JF, Masclaux-Daubresse C. (2006) The two

senescence-related markers, GS1 (cytosolic glutamine synthetase) and GDH (glutamate

Bibliografía

103

dehydrogenase), involved in nitrogen mobilization, are differentially regulated during

pathogen attack and by stress hormones and reactive oxygen species in Nicotiana

tabacum L. leaves. J Exp Bot 57: 547-557.

Polle A. (2001) Dissecting the superoxide dismutase-ascorbate-glutathione-pathway in

chloroplasts by metabolic modeling. Computer simulations as a step towards flux

analysis. Plant Physiol 126: 445-462.

Pompelli MF, Martins SCV, Antunes WC, Chaves ARM, DaMatta FM. (2010) Photosynthesis

and photoprotection in coffee leaves is affected by nitrogen and light availabilities in

winter conditions. J Plant Physiol 167: 1052-1060.

Prášil O, Adir N, Ohad I. (1992) Dynamic of PSII: Mechanism of photoinhibition and recovery

process. In: Baber J, ed. The photosystems: structures, function and molecular biology.

Amsterdam, Elsevier, pp. 295-348.

Pritchard SG, Ju Z, van Santen E, Qiu J, Weaver DB, Prior SA, Rogers HH. (2000) The influence

of elevated CO2 on the activities of antioxidative enzymes in two soybean genotypes.

Aust J Plant Physiol 27: 1061-1068.

Procházková D, Wilhelmova N. (2007) Leaf senescence and activities of the antioxidant

enzymes. Biol Plant 51: 401-406.

Purnell MP, Botella JR. (2007) Tobacco isoenzyme 1 of NAD(H)-dependent glutamate

dehydrogenase catabolizes glutamate in vivo. Plant Physiol 143: 530-539.

Putt ED. (1997) Early history of sunflower. In: Schneiter AA, ed. Agronomy series 35. Madison,

American Society of Agronomy, pp. 1-19.

Qiu QS, Huber JL, Booker FL, Jain V, Leakey ADB, Fiscus EL, Yau PM, Ort DR, Huber SC.

(2008) Increased protein carbonylation in leaves of Arabidopsis and soybean in response

to elevated [CO2]. Photosynthesis Res 97: 155-166.

Quesada A, Gómez-García I, Fernández E. (2000) Involvement of chloroplast and mitochondria

redox valves in nitrate assimilation. Trends Plant Sci 5: 463-464.

Quirino BF, Noh YS, Himelblau E, Amasino RM. (2000) Molecular aspects of leaf senescence.


Bibliografía

104

Radochová B, Tichá I. (2008) Excess irradiance causes early symptoms of senescence during leaf

expansion in photoautotrophically in vitro grown tobacco plants. Photosynthetica 46:

471-475.

Reich PB, Hungate BA, Luo YQ. (2006) Carbon-nitrogen interactions in terrestrial ecosystems in

response to rising atmospheric carbon dioxide. Annu Rev Ecol, Evol Syst 37: 611-636.

Riikonen J, Kets K, Darbah J, Oksanen E, Sober A, Vapaavuori E, Kubiske ME, Nelson N,

Karnosky DF. (2008) Carbon gain and bud physiology in Populus tremuloides and Betula

papyrifera grown under long-term exposure to elevated concentrations of CO2 and O3.

Tree Physiol 28: 243-254.

Riikonen J, Percy KE, Kivimäenpää M, Kubiske ME, Nelson ND, Vapaavuori E, Karnosky DF.

(2010) Leaf size and surface characteristics of Betula papyrifera exposed to elevated CO2

and O3. Environ Pollut 158: 1029-1035.

Rogers A, Allen D, Davey P, Morgan P, Ainsworth E, Bernacchi C, Cornic G, Dermody O,

Dohleman F, Heaton E. (2004) Leaf photosynthesis and carbohydrate dynamics of

soybeans grown throughout their life-‐‑cycle under free-‐‑air carbon dioxide enrichment.

Plant Cell Environ 27: 449-458.

Salvucci ME, Crafts-‐‑Brandner SJ. (2004) Inhibition of photosynthesis by heat stress: the

activation state of rubisco as a limiting factor in photosynthesis. Physiol Plant 120: 179-

186.

Sanz-Sáez Á, Erice G, Aranjuelo I, Nogués S, Irigoyen JJ, Sánchez-Díaz M. (2010)

Photosynthetic down-regulation under elevated CO2 exposure can be prevented by

nitrogen supply in nodulated alfalfa. J Plant Physiol 167: 1558-1565.

Schansker G, van Rensen JJ. (1999) Performance of active photosystem II centers in

photoinhibited pea leaves. Photosynth Res 62: 175-184.

Scheurwater I, Dunnebacke M, Eising R, Lambers H. (2000) Respiratory costs and rate of protein

turnover in the roots of a fast-growing (Dactylis glomerata L.) and a slow-growing

(Festuca ovina L.) grass species. J Exp Bot 51: 1089-1097.

Schippers JH, Schmidt R, Wagstaff C, Jing HC. (2015) Living to die and dying to live: the

survival strategy behind leaf senescence. Plant Physiol 169: 914-930.

Bibliografía

105

Schrader SM, Wise RR, Wacholtz WF, Ort DR, Sharkey TD. (2004) Thylakoid membrane

responses to moderately high leaf temperature in Pima cotton. Plant Cell Environ 27:

725-735.

Schneider SH. (1989) The greenhouse effect: science and policy. Science 243: 771-781.

Semenova G. (2004) Structural reorganization of thylakoid systems in response to heat treatment.

Photosynthetica 42: 521-527.

Srivalli B, Khanna-Chopra R. (2004) The developing reproductive ‘sink’ induces oxidative stress

to mediate nitrogen mobilization during monocarpic senescence in wheat. Biochem

Biophys Res Commun 325: 198-202.

Srivalli B, Khanna-Chopra R. (2009) Delayed wheat flag leaf senescence due to removal of

spikelets is associated with increased activities of leaf antioxidant enzymes, reduced

glutathione/oxidized glutathione ratio and oxidative damage to mitochondrial proteins.

Plant Physiol Biochem 47: 663-670.

Srivastava S, Pathak AD, Gupta PS, Shrivastava AK, Srivastava AK. (2012) Hydrogen peroxide-

scavenging enzymes impart tolerance to high temperature induced oxidative stress in

sugarcane. Biol J Environ 33: 656-661.

Stitt M, Krapp A. (1999) The interaction between elevated carbon dioxide and nitrogen nutrition:

the physiological and molecular background. Plant Cell Environ 22: 583-621.

Swarbreck SM, Defoin-Platel M, Hindle M, Saqi M, Habash DZ. (2011) New perspectives on

glutamine synthetase in grasses. J Exp Bot 62: 1511-1522.

Taiz L, Zeiger E. (2010) Plant physiology fith edition. Sunderland, Massachusetts. VSA. Sinauer

Associates, Inc., Publisher.

Takahashi S, Murata N. (2008) How do environmental stresses accelerate photoinhibition?


Taylor KE, MacCracken MC. (1990) Projected effects of increasing concentrations of carbon

dioxide and trace gases on climate. In: Kimball BA, ed. Impact of carbon dioxide, trace

gases, and climate change on global agriculture. Madison, American Society of

Agronomy, Crop Science Society of America, and Soil Science Society of America, pp.

1-17.

Bibliografía

106

Templer PH, Pinder RW, Goodale CL. (2012) Effects of nitrogen deposition on greenhouse-gas

fluxes for forests and grasslands of North America. Front Ecol Environ 10: 547-553.

Tsukaya H. (2006) Mechanism of leaf-shape determination. Annu Rev Plant Biol 57: 477-496.

Vanacker H, Sandalio LM, Jimenez A, Palma JM, Corpas FJ, Meseguer V, Gomez M, Sevilla F,

Leterrier M, Foyer CH, del Rio LA. (2006) Roles for redox regulation in leaf senescence

of pea plants grown on different sources of nitrogen nutrition. J Exp Bot 57: 1735-1745.

Wallsgrove RM, Turner JC, Hall NP, Kendall AC, Bright SW. (1987) Barley mutants lacking

chloroplast glutamine synthetase-biochemical and genetic analysis. Plant Physiol 83: 155-

158

Wang J, Cui L, Wang Y, Li J. (2009) Growth, lipid peroxidation and photosynthesis in two tall

fescue cultivars differing in heat tolerance. Biol Plant 53: 237-242.

Wiedemuth K, Müller J, Kahlau A, Amme S, Mock H, Grzam A, Hell R, Egle K, Beschow H,

Humbeck K. (2005) Successive maturation and senescence of individual leaves during

barley whole plant ontogeny reveals temporal and spatial regulation of photosynthetic

function in conjunction with C and N metabolism. J Plant Physiol 162: 1226-1236.

Wingler A, Marès M, Pourtau N. (2004) Spatial patterns and metabolic regulation of

photosynthetic parameters during leaf senescence. New Phytol 161: 781-789.

Wingler A, Purdy S, MacLean JA, Pourtau N. (2006) The role of sugars in integrating

environmental signals during the regulation of leaf senescence. J Exp Bot 57: 391-399.

Wingler A, Roitsch T. (2008) Metabolic regulation of leaf senescence: interactions of sugar

signalling with biotic and abiotic stress responses. Plant Biol 10: 50-62.

Wingler A, Masclaux-Daubresse C, Fischer AM. (2009) Sugars, senescence, and ageing in plants

and heterotrophic organisms. J Exp Bot 60: 1063-1066.

Wollenweber B, Porter J, Schellberg J. (2003) Lack of Interaction between extreme high-‐‑

temperature events at vegetative and reproductive growth stages in wheat. J Agr Crop Sci

189: 142-150.

Xu S, Li J, Zhang X, Wei H, Cui L. (2006) Effects of heat acclimation pretreatment on changes

of membrane lipid peroxidation, antioxidant metabolites, and ultrastructure of

chloroplasts in two cool-season turfgrass species under heat stress. Environ Exp Bot 56:

274-285.

Bibliografía

107

Xue W, Li XY, Zhu JT, Lin LS. (2012) Effects of temperature and irradiance on photosystem

activity during Alhagi sparsifolia leaf senescence. Biol Plant 56: 785-788.

Zapata JM, Guera A, Esteban-Carrasco A, Martin M, Sabater B. (2005) Chloroplasts regulate

leaf senescence: delayed senescence in transgenic ndhF-defective tobacco. Cell Death

Differ 12: 1277-1284.

Zhang J, Li DM, Gao Y, Yu B, Xia C, Bai J. (2012) Pretreatment with 5-aminolevulinic acid

mitigates heat stress of cucumber leaves. Biol Plant 56: 780-784.

Zhu C, Zhu J, Zeng Q, Liu G, Xie Z, Tang H, Cao J, Zhao X. (2009) Elevated CO2 accelerates

flag leaf senescence in wheat due to ear photosynthesis which causes greater ear nitrogen

sink capacity and ear carbon sink limitation. Funct Plant Biol 36: 291-299.

Zozaya-Hinchliffe M, Potenza C, Ortega JL, Sengupta-Gopalan C. (2005) Nitrogen and

metabolic regulation of the expression of plastidic glutamine synthetase in alfalfa

(Medicago sativa). Plant Sci 168: 1041-1052.

Zulfugarov IS, Tovuu A, Kim J, Lee C. (2011) Detection of reactive oxygen species in higher

plants. J Plant Biol 54: 351-357.

Efecto de factores ambientales sobre la regulación del desarrollo de ...

Documents

Transcript of Efecto de factores ambientales sobre la regulación del desarrollo de ...