Quimeras en Cabras

7/30/2019 Quimeras en Cabras

http://slidepdf.com/reader/full/quimeras-en-cabras 1/9



cells have been reported in a variety of animals, including

mice [12–15], rats [16], rabbits [17], sheep [18], cattle

[19], and pigs [20–22], chimeras derived from EG cells

have only been reported in mice [23,24] and pigs [25,26],but notin goats. To determine if caprine EG cells have the

pluripotency to generate all three germ layers and form

chimeras when injected into host blastocysts, we isolated

EG cells from goat fetuses and injected these cells into

host blastocysts.

2. Materials and methods

2.1. Materials and animals

The sources of materials were: Dulbecco’s modifiedEagle’s medium (DMEM) and knockout serum repla-

cement (KSR; Gibco, Life Technologies, Grand Island,

NY, USA); nonessential amino acids, b-mercaptoetha-

nol, and L-glutamine (Invitrogen Corp., Carlsbad, CA,

USA); dNTPs (Takara. Bio Inc., Otsu, Japan); cDNA II

kit (Ambion Europe Ltd., Huntingdon, Cambridgeshire,

UK); recombinant murine leukemia inhibitory factor

(LIF), human recombinant basic fibroblast growth

factor (bFGF), stem cell factor (SCF), and antibodies

against SSEA-1 and c-kit (Chemicon International Inc.,

Temecula, CA, USA); pregnant mare serum gonado-

tropin (PMSG) and prostaglandin (PGF2a; NingboHormone Co., Ningbo, Zhejiang, China). Unless

otherwise indicated, all other chemicals were purchased

from the Sigma chemical company (St. Louis, MO,

USA).

Local black goats were used to produce host

blastocysts, whereas white Guanzhong goats were used

as a source of EG cells and to serve as surrogates. The

coat color of the local breed was completely black;

however, when these goats were crossed with a white

Guanzhong goat, the coat color of the resulting kids was

brown (no black hair nor white spots).

2.2. Isolation and culture of goat embryonic germ

cells

To isolate PGCs, nine fetuses were collected fromseven white Guanzhong dairy goat fetuses at 28–42 days

of pregnancy (Table 1). The gonadal ridge tissue was

removed, washed three times with PBS plus 0.02%

ethylenediaminetetraacetic acid (EDTA), dissected

manually, and incubated for 30 min at 38.5 8C in a cell

dissociation solution containing 0.25% collagenase IV.

The cell suspension was filtered through sterile gauze

(100 mesh, 149 mm) and washed in PBS once, then

pelleted by centrifugation at 1000 Â g for 5 min. The

suspension of cell mixture of gonadal tissue was co-

cultured with goat embryonic fibroblasts (GEF) that hadbeen inactivated with mitomycin C treatment on gelatin-

coated culture dishes. After 10–12 days of growth, EG-

like cell colonies with 100–200 cells were formed and

then subcultured by picking up individual colonies and

seeding on 35 mm culture dish; this subculture was

considered the first passage of EG cells. Although goat

EG cells can grow well with both GEF and mouse

embryonic fibroblast (MEF), we routinely used MEF as

the feeder cells to culture goat EG cells, since it was

easier to use. For the immunohistochemistry assay, MEF

and EG cells were cultured on cover slides that were laid

on a culture plate. The culture medium was DMEMsupplemented with 15% KSR, 1000 IU/mL LIF, 10 ng/

mL bFGF, 10 ng/mL SCF, 0.1 mM nonessential amino

acids, 0.1 mM b-mercaptoethanol, 2 mM L-glutamine,

100 IU/mL penicillin, and 0.1 mg/mL streptomycin. The

above three factors, LIF, bFGF and SCF, were always

added in media as supplements, even when typical EG

colonies were formed.

The isolated EG cells were cryopreserved in liquid

nitrogen by a method similar to that used for MEF cells.

Briefly, 5 Â 105 cells collected from cultural plates

were pelleted in a 10 mL centrifuge tube, and

W. Jia et al. / Theriogenology 69 (2008) 340–348 341

Table 1

Isolation of PGCs from caprine fetuses

Goat Fetus Gestational

age (days)

Fetus length (cm) EG cells Passage no.a

1 1 28 1.2 EGC#1 P3

2 2a 35 1.7 EGC#2 P3

2b 35 1.8 EGC#3 P123 3 35 2.1 EGC#4 P12

4 4 42 4.5 EGC#5 P0

5 5 35 2.4 EGC#6 P10

6 6 35 2.0 EGC#7 P8

7 7a 37 2.6 EGC#8 P10

7b 37 2.8 EGC#9 P9

a The last passage of EG cells that were cultured in medium.



resuspended in 1 mL of cryo-storage solution contain-

ing DMEM with 20% fetal bovine serum and 10%

dimethyl sulfoxide. Cells were then transferred to a

storage tube (2 mL) and stored in liquid nitrogen. To

reuse the cryopreserved cells, a tube of cells was

removed from liquid nitrogen and immediately trans-

ferred to a 37 8C water bath to incubate for 1–2 min.The thawed cells were subsequently cultured in the

60 mm plate with MEF feeder cells.

2.3. Immunohistochemistry and cellular assay

To characterize the origin of the isolated cells, we

determined several stem cell specific markers. To

confirm the presence of alkaline phosphotase (AP), EG

cells grown on a cover slide were fixed with 4%

paraformaldehyde for 20 min, washed 10 min with PBS

for three times, and stained with 200 mg/mL of naphtholAS-MX phosphate and 1 mg/mL of Fast Red TR in

0.1 mM Tris buffer (pH 8.2) for 15 min at room

temperature. To detect cell surface markers, cells fixed

with 4% paraformaldehyde were incubated with 3%

H2O2 for 5 min, and blocking solution for 15 min;

antibodies against SSEA-1 (1:100) and c-kit (1:50) were

incubated separately with cells for 12 h at 4 8C. The

secondary goat anti-mouse IgG antibody and chromo-

gen solutions (3,3-diaminobenzidine; DAB), were

applied according to the manufacturer’s instructions

(Beijing ZhongShan Golden Bridge, Beijing, China).Positive cells were detected by red/brown staining and

the control was only incubated with secondary antibody,

followed by staining. In the karyotype assay, EG cells at

the stage of exponential growth were treated with

0.1 mg/mL colcemid for 2 h, and then spread and dried

on the glass slide. The karyotype was determined by

microscopic examination after conventional Giemsa

staining.

2.4. RT-PCR reaction

An RT-PCR was done to detect the Nanog gene thatis specifically expressed in ES cells. The EG cells were

lysed by incubation at 75 8C for 10 min with cell lysate

buffer. Genomic DNA was degraded by incubation with

DNAase I for 15 min at 37 8C; 0.5 mg of total RNAwas

used to synthesize cDNA by MLV reverse transcriptase

and random hexamers using cDNA II kit in 10mL

reaction volume. We subsequently used 5 mL of the

reverse transcription products in the subsequent PCR to

amplify the Nanog gene. The PCR were conducted in a

total volume of 25 mL at 35 cycles of 94 8C for 30 s,

558C for 30 s, and 72

8C for 80 s; PCR products were

separated on 1.0% agarose gel with ethidium bromide.

Reverse transcriptase negative controls were included to

monitor genomic contamination. Primers based on goat

Nanog gene (AY786437) were synthesized to amplify

the 819 bp cDNA fragment. The sequence of primers

was F-Nanog: 50ATGCCTGAAGAAAGTTACGC, and

R-Nanog: 50AGGCTGTATGTTGAGAGGGT.

2.5. Generation of chimera

The EG cells were cultured for three or four passages

and incubated for 30 min in 0.05% trypsin and 0.02%

EDTA. After neutralization by culture medium, cells

formed small clusters (which contained 10–20 cells). By

using a microinjector (Leica, DM IRB, Wetzlar,

Germany) with a protocol similar to that described by

Schoonjans [17], an EG cell cluster was delivered into a

blastocyst that was isolated from a naturally mated black goat and cultured for 7 days in vitro (Fig. 1A). The

injected blastocysts were incubated in a CO2 incubator

for 30 min, and then immediately transferred into white

recipient goats on Day6 (estrus = Day 0). To synchronize

estrus, recipient goats were given an intravaginal

progestagen-impregnated sponge (Ova-Gest; Bioniche

Australasia, Armidale, NSW, Australia) for 10 days;

goats were injected with 200 IU PMSG 7 days after

sponge insertion, followed by 0.2 mg PGF2a 24 and 12 h,

respectively, before sponge removal. Goats were

observed frequently for estrous activity for 48 h (starting24 h after the second PGF2a treatment).

2.6. Characterization of chimeric kids

For characterization of chimeric kids, DNA samples

were isolated from EG cells and tissues including blood

and skin (from the head) with whitehair or with black hair

from both male and female kids, and from various tissues

(includingliver,placenta, lung,heart, spleen, muscle, and

brain) from the dead fetus. The DNA samples were also

isolated from ear skin of black Dam #1 and Sire #1 of the

host blastocyst and surrogatewhite Dam #2. We used a Y-chromosome-specific gene SRY (Z30646) to determine

if the injected EG cells had differentiated into various

tissues and organs. To detect this gene, two pairs of

primers were synthesized according to a published

sequence [27]. The primer sequences were:

SRY, forward: 50ATGAATAGAACGGTGCAATCG 30

SRY, reverse: 50GAAGAGGTTTTCCCAAAGGC30

Aml-X, forward: 50CAGTAGCTCCAGCTCCAG

CT30

Aml-X, reverse: 50

GTGCATCCCTTCATTGGC30

W. Jia et al. / Theriogenology 69 (2008) 340–348342



The 116 bp fragment of Y-chromosome-specific

gene SRY and 300 bp fragment of internal control

gene Aml-X (AF215887) were amplified by PCR,

performed in 20 mL of reaction mixture that contained

20 ng DNA, 200 mM of dNTP, 1.5 mM MgCl2, 10 pmol

of forward and reverse primers, 0.4 U Taq DNA

polymerase, and carried out for 36 cycles of 94 8C

for 30 s, 58 8C for 30 s, and 72 8C for 45 s. The PCR

products were separated by 12% polyacrylamide gel

electrophoresis and visualized by silver staining.

2.6.1. Microsatellite assay

Ten microsatellite markers, including BMS1004,

BMS1290, BM203, BMS875, BMS574, SR-CRSP1,

SR-CRSP5, SR-CRSP24, OarAE101, and OarFCB11

were selected to characterize the chimerism of the

newborn kids. The PCR were conducted with 20 ng

DNA template isolated from skin and blood samples,with 32 cycles of 94 8C for 30 s, 55 8C for 30 s, and

72 8C for 45 s. The amplified DNA fragments were

separated on 15% polyacrylamide gel and visualized by

silver staining.

3. Results

3.1. Derivation and characterization of goat EG

cell lines

The PGCs isolated from fetal gonads were round oroval, and had a large nucleus and a high nucleus-to-

plasma ratio. When subcultured on feeder layers for 3–5

days, PGCs started to form clusters with morphology

typical of ES cells (Fig. 2A). We isolated eight EG-like

cells from nine fetuses; it was easier to successfully

isolate EG cells from fetal gonads at 35–37 days,

compared to those at 28 or 42 days. Two isolated EG

cells, EGC#3 and EGC#9, had a normal male karyotype

and were used for blastocyst injections (Table 1). The

isolated EG cells were cultured up to 12 passages

without loss of AP activity (Fig. 2B). The EG cellcolonies also had positive staining for SSEA-1 and c-kit

(Fig. 2C and D). At passage 12, the proportion of

isolated EG cells in the entire culture was low, due to

spontaneous differentiation. However, the remaining

EG cells still had AP activity and were positive for

SSEA-1 and c-kit. To determine if the EG cells

contained the ES cell-specific transcription factor, RT-

PCR was done to monitor Nanog mRNA expression;

both PGCs and EG cells expressed the Nanog gene

(Fig. 3). Based on all of these assessments, the isolated

cells were EG cells and had stem cell features.

3.2. Production of chimera

Twenty-nine injected blastocysts, of which ten used

cryopreserved EG cells, were implanted in nine white

surrogate goats. One surrogate goat, Dam #2, main-

tained pregnancy to full term, and gave birth to three

kids, including a dead malformed fetus of undetermined

gender with three legs and failure of the abdominal wall

to close Table 2. One kid, a black male, was designated

GB1 and the other, a black female with a large white

spot on her forehead (Fig. 1B), was designated GBW1.


Fig. 1. Blastocyst injection and chimeric goats. The blastocyst from

the black femalehost was injected with approximately 10–20 EG cells

from a white male goat fetus;injectedblastocystswere transferred into

a white recipient goat. (A) EG cells were injected into the blastocyst;

(B) two kids a few minutes after birth; (C) dead, malformed fetus

(gender unknown; all three fetuses were littermates). The arrows

indicated the white hair in both the female kid and the dead fetus

(they were chimeras).



The malformed fetus (GBW2) also had white hair that

covered a much larger area of the head than that in

GBW1 (Fig. 1C). Although we had implanted only two

injected blastocysts into Dam #2, that she gave birth to

three kids (in conjunction with other evidence), we

inferred that both female kid GBW1 and malformed

fetus GBW2 were monozygotic twins.

3.3. Molecular analysis of newborn kids

To determine if the newborn kids were chimeras, the

SRY gene was analyzed by PCR. The Aml-X gene (X

amelogenin) co-amplified in PCR assay was used as an

internal control to detect the X-chromosome marker.

We injected EG cells from a white male goat into the

blastocyst of a black goat; if the injected blastocysts

developed to form a fetus, the chimera was expected to

retain two features, white hair and SRY gene positive,

especially in a female offspring. Kid GBW1 not only

had white hair (Fig. 1B), it also had the SRY gene, even


Fig. 2. Isolation and characterization of goat EG cells. The isolated goat EG cells formed a colony with typical morphology of pluripotent stem cells(A: 200Â); the EG cell colony was positive for alkaline phosphatase activity (B: 200Â), SSEA-1 (C: 200Â), and c-kit (D: 400Â).

Fig. 3. The RT-PCR reaction analysis of Nanog gene in isolated EG

cells. The RT-PCR reactions were done with Nanog gene primers and

the primary culture of goat PGCs (column 1) or EG cells in passages 3

or 4 (column 2). Column 3 was the negative control and M was the

1500 bp DNA ladder.



though it was a female goat (Fig. 4, column 3). The dead

fetus (GBW2) also had white hair on its head and the

SRY gene; therefore, both GBW1 and GBW2 were

chimeric goats (Fig. 4, column 2).

To further characterize the degree of chimerism, 10

microsatellite markers were analyzed on DNA samples

isolated from GB1, GBW1, and GBW2, the parents of

the host blastocyst (Dam #1 and Sire #1) as well as EGcells and Dam #2. Among the ten markers, there were

three markers (BMS574, BMS875, and BMS1004) that

demonstrated the variation between chimera and normal

goats. The microsatellite assay (Fig. 5a) was based on

marker BMS574; both GBW1 and GBW2 had an

identical DNA pattern, which was significantly different

from the pattern in GB1. On the gel, there were two

groups of DNA bands in GBW1 and GBW2. One group

of bands in the 200 bp area consisted of the combined

bands from both EG cells and parent goat DNA. The

second group of bands in the 300 bp area had two bands,one from the EG cell and the other from Sire #1;

however, the bands in the second group were not present

in samples from Dam #1 and Dam #2. Additionally,

GB1 had a similar DNA pattern to that of Sire #1, but

completely different from that of the EG cells,

indicating that GB1 was not a chimera (Fig. 5a). Blood

samples from GB1 and GBW1 were also analyzed by

marker BMS574; these samples had DNA fingerprint-

ing similar to that from skin samples, suggesting that the

EG cells can differentiate into blood cells in a chimeric

goat (Fig. 5b).

Based on microsatellite assays, EG cells in GBW1

developed into skin and blood. To determine if EG cells

were able to differentiate into other tissues and organs,

we collected GBW2 tissues that covered all three germ

layers, including skin areas with white and black hair,

liver, placenta, lung, heart, spleen, muscle, and brain,

and did microsatellite assays with BMS574 marker. All

tissues tested had the EG cell signal, indicating that EGcells in the injected blastocyst differentiated into all

three germ layers (Fig. 5c). In addition to using

BMS574 marker, similar experiments were done with


Table 2

Caprine chimeras produced by microinjection of EG cells into blastocysts

Blastocysts injected Recipients Term pregnancies Kids Chimeras

EGC#3a 7 4 1 3 2c

Cryo-EGC#3b 10 2 0 0 0

EGC#9a 12 3 0 0 0

a EGC#3 was at passage 4 and EGC#9 was at passage 3.b EGC#3 were cryopreserved in liquid nitrogen, thawed and used.c One of the chimeras was a dead, malformed fetus.

Fig. 4. The PCR assay for SRY and Aml-X genes. The SRY gene

fragment (116 bp) and Aml-X gene fragment (300 bp) were amplified

from EG cells (column 1), the malformed fetus (column 2), female kid

(column 3), male kid (column 4), Dam #1 (column 5), Sire #1 (column

6), and the negative control (column 7). M was a 100 bp DNA ladder.

Fig. 5. Microsatellite assays with BMS574 marker; PCR products

were separated with a 15% polyacrylamide gel. (a) DNA from skin

tissue or EG cells was used for the assay; (b) assay of blood samples

from two newborn kids; (c) assay of nine tissues from the malformed

dead fetus. M , 100 bp DNA marker; FL, Dam #1; ML, Sire #1; EG,

embryonic germ cell; RP, Recipient Dam #2; GB1, male kid; GBW1,

female kid; GBW2, malformed dead fetus; WS, skin from white hair

area; LV, liver; BS, skin from black hair area; CL, placenta; LG, lung;

HT, heart; SP, spleen; MS, muscle; BR, brain.



markers BMS875 and BMS1004. Both GBW1 and

GBW2 had identical DNA bands (Fig. 6a and b) whichwere completely different from that of GB1. In

summary, we concluded that GB1 was a normal kid

without heterozygosis, and GBW1 and GBW2 were

chimeric kids and monozygotic twins.

4. Discussion

The EG cell lines were derived from cultured PGCs

in media containing LIF, FGF2, and SCF. Compared

with isolation of embryonic cells from the inner cell

mass (ICM) of embryos, the advantage of using PGCs to

purify stem cells was that an aborted fetus was easier to

obtain [28]. However, the primary PGCs were difficult

to subculture and passage; cell-to-cell bonds among

PGCs were tighter than those of embryonic cells derived

from the ICM [7]. To isolate goat PGCs, antibodies

against SSEA-1 and EMA-1 were applied on a flow

cytometer to collect marker-specific PGCs [10]. In theearly 1980’s, Felice et al. established three approaches

to isolate murine PGCs, including collagenase treat-

ment and mechanical procedures, with or without prior

EDTA treatment [23]. To improve isolation efficiency,

we incubated genital ridge segments with 0.02% EDTA

for 20 min, and then incubated them with 0.25%

collagenase IV for 25–30 min. Using this approach,

PGCs were isolated and continually cultured in vitro for

up to 12 passages. The EG cells derived from PGCs of

Guanzhong goats had embryonic stem cell features and

could differentiate into multiple cell types [32].The proliferation and differentiation of goat EG cells

have been reported previously, although the focus was

mainly on the isolation of goat PGCs and culture of EG

cells [7–10]. Lee et al. reported that the AP-positive

PGCs were isolated from a Day 25 goat fetus; these

isolated EG cells were only maintained for four

passages in culture medium [7,9]. Until now, only

Tillmann’s group reported that goat ES cells could be

cultured for prolonged intervals in vitro [11]. There was

no previous report describing a chimeric goat with EG

cells. In our study, we not only successfully isolated andcultured goat PGCs, but also purified EG cells up to 12

passages and document their pluripotency, demonstrat-

ing that they could differentiate into three germ layers in

vivo. However, it is difficult to construct a goat EG cell

line; we still face the difficulty of culturing isolated EG

cells for prolonged intervals without spontaneous

differentiation.

Ten microsatellite markers were used to determine

whether the progeny were chimeras; however, only

three markers, BMS574, BMS875, and BMS1004,

detected differences among EG cells, the parents, and

the newborn kids. Similar observations were reported inpig chimeras that were created by delivering porcine EG

cells into recipient blastocysts [25,26]. On marker

BMS574 assays, GBW1 had chimeric skin and blood

that the only tissues were tested, whereas in GBW2, all

nine tissues and organs tested were chimeric. Therefore,

these EG cells were capable of differentiating into three

germ layers without affecting tissue functions; GBW1

was healthy at birth and has already lived 11 months. In

contrast, Shim et al. reported that stated that in a porcine

chimera, chimerism only occurred in blood, brain,

pancreas and muscle, but not in heart, spleen, liver, or


Fig. 6. Microsatellite assays of DNA samples, isolated from skin of

littermate goat kids, conducted with markers BMS875 (a) and

BMS1004(b). PCRproducts were separatedon a 15% polyacrylamide

gel. GB1, newborn male kid; GBW1, newborn female kid; GBW2,

malformed dead fetus.



lung [25]. There are many factors affecting the

developmental capability of EG cells after they are

delivered into a blastocoelic cavity, including viability

of the EG cells, the number of cells injected, and the

interaction between EG cells and ICM, etc. Soon after

EG cells were involved in blood tissue formation, they

were also able to proliferate and differentiate into othertissues and organs, as well as obtain immune tolerance

[29–31].

To further characterize goat chimeras, the SRY gene,

a male gender-specific gene, was analyzed by PCR. The

experiment was designed so that the injected EG cells

contained a Y-chromosome, and if a newborn female

kid had an SRY gene, the animal would be a chimera.

Both GBW1 and GBW3 retained the SRY gene, similar

to that of the injected EG cells. How male cells were

chimerically present in the female tissue and whether

the XY EG cells can develop into the genital tissue, isyet to be determined. However, we plan to raise GBW1

and to determine if it has normal estrous cycles,

ovulation, and fertilization.

This study is the first report of a chimeric goat derived

by injecting caprine embryonic germ (EG) cells into a

host blastocyst. Furthermore, it was noteworthy that the

EG cells differentiated into all three germ layers in vivo.

Acknowledgments

We thank: Dr Hong Chen for discussion; JingzhuangFan and Xiaoliang Han for technical support; Dr Rachel

Maier for comments on the manuscript. This work was

supported in part by grants from the National High-Tech

Research and Development Program of China

(2005AA21905) and the Key Program of Shaanxi

Province (4130253301).

References

[1] Matsui Y, Zsebo K, Hogan BL. Derivation of pluripotential

embryonic stem cells from marine primordial germ cells in

culture. Cell 1992;70:841–7.

[2] Tesar PJ. Derivation of germ-line-competent embryonic stem

cell lines from preblastocyst mouse embryos. Proc Natl Acad Sci

USA 2005;102:8239–44.

[3] Nagy A, Gocza E, Diaz EM, Prideaux VR, Ivanyi E, Markkula

M, et al. Embryonic stem cells alone are able to support fetal

development in the mouse. Development 1990;110:815–21.

[4] Wakayama S, Hikichi T, Suetsugu R, Sakaide Y, Bui HT,

Mizutani E, et al. Efficient establishment of mouse embryonic

stem cell lines from single blastomeres and polar bodies. Stem

Cells 2007;25:986–93.

[5] Martin GR. Isolation of a pluripotent cell line from early mouse

embryos cultured in medium conditioned by teratocarcinoma

stem cells. Proc Natl Acad Sci USA 1981;78:7634–8.

[6] Kerr CL,Gearhart JD,Elliott AM, Donovan PJ.Embryonic germ

cells: when germ cells become stem cells. Semin Reprod Med

2006;24:304–13.

[7] Labosky P, Barlow D, Hogan B. Mouse embryonic germ (EG)

cell lines: transmission through the germ line and differences in

the methylation imprint of insulin-like growth factor 2 receptor

(Igf2r) gene compared with embryonic stem (ES) cell lines.

Development 1994;120:3197–204.[8] Lee CK, Scules N, Newton G, Piedrahita JA. Isolation and initial

characterization of primordial germ cell (PGC)-derived from

goat, rabbit and rats. Theriogenology 1998;49:388.

[9] Lee CK, Moore K, Scales N, Westhusin M, Newton G, Im KS,

et al. Isolation and genetic transformation of primordial germ

cell (PGC) derived cells from cattle, goats, rabbits and rats.

Asian Aus Anim Sci 2000;13:587–94.

[10] Kuhholzer B, Baguisi A, Overstrom EW. Long-term culture and

characterization of goat primordial germ cells. Theriogenology

2000;53:1071–9.

[11] Tillmann SM, Meinecke B. Isolation of ES-like cell lines from

bovine and caprine preimplantation embryos. J Anim Breed

Genet 1996;113:413–21.

[12] Evans M, Kaufman M. Establishment in culture of pluripotential

cells from mouse embryos. Nature 1981;292:154–6.

[13] Li XY, Jia Q, Di KQ, Gao SM, Wen XH, Zhou RY, et al. Passage

number affects the pluripotency of mouse embryonic stem cells

as judged by tetraploid embryo aggregation. Cell Tissue Res

2007;327:607–14.

[14] Li X, Yu Y, Wei W, Yong J, Yang J, You J, et al. Simple and

efficient production of mice derived from embryonic stem cells

aggregated with tetraploid embryos. Mol Reprod Dev

2005;71:154–8.

[15] Lee KH, Chuang CK, Wang HW, Stone L, Chen CH, Tu CF. An

alternative simple method for mass production of chimeric

embryos by coculturing denuded embryos and embryonic stem

cells in Eppendorf vials. Theriogenology 2007;67:228–37.[16] Iannaccone P, Taborn G, Garton R, Caplice MD, Brenin DR.

Pluripotent embryonic stem cells from the rat are capable of

producing chimeras. Dev Biol 1994;163:288–92.

[17] Schoonjans L, Albright GM, Li JL, Collen D, Moreadith RW.

Pluripotential rabbit embryonic stem (ES) cells are capable of

forming overt coat color chimeras following injection into

blastocysts. Mol Reprod Dev 1996;45:439–43.

[18] Butler JE, Anderson GB, BonDurant RH, Pashen RL, Penedo

MCT. Production of ovine chimeras by inner cell mass trans-

plantation. J Anim Sci 1987;65:317–24.

[19] Iwasakia S, Campbellb KH, Gallic C, Akiyamad K.

Production of live calves derived from embryonic stem-like

cells aggregated with tetraploid embryos. Biol Reprod 2000;

62:470–5.[20] Onishi A, Takeda K, Komatsu M, Akita T, Kojima T. Production

of chimeric pigs and the analysis of chimerism using mitochon-

drial deoxyribonucleic acid as a cell marker. Biol Reprod

1994;51:1069–74.

[21] Anderson GB,Choi SJ,BonDurant RH.Survival of porcine inner

cell masses in culture and after injection into blastocysts.

Theriogenology 1994;42:204–12.

[22] Nagashima H, Giannakis C, Ashman RJ, Nottle MB. Sex

differentiation and germ cell production in chimeric pigs pro-

duced by inner cell mass injection into blastocysts. Biol Reprod

2004;70:702–7.

[23] Felice MD, McLaren A. Isolation of mouse primordial germ

cells. Exp Cell Res 1982;142:476–83.


Quimeras en Cabras

Documents

Transcript of Quimeras en Cabras